Aspergillus niger gene knockout method

A gene knockout, Aspergillus niger technology, applied in the biological field, can solve the problems of time-consuming and laborious transformation of Aspergillus niger, and the bacteriostatic effect of 5-fluoroorotic acid is not obvious, so that the yield is not affected, the shape is normal, and the hygromycin Resistance removal effect

Inactive Publication Date: 2015-12-30
JIANGNAN UNIV
View PDF1 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Limited resistance markers limit possibilities for multistep genetic manipulation of A. niger
When using auxotrophic complementary genes to screen positive clones, it is necessary to perform multiple rounds of genetic manipulation on auxotrophic strains using pyrG for forward and reverse bidirectional selection, but for wild-type strains, the antibacterial effect of 5-fluoroorotic acid is not Not obvious, and the pyrG gene needs to be knocked out first to get an auxotrophic strain
At present, when using the hygromycin resistance gene to screen positive clones, the hygromycin resistance between the loxP sites is knocked out by transiently expressing the CRE protein and transforming the commercialized CRE enzyme. Transformation of Aspergillus niger is required to eliminate resistance and elimination of resistance, and transformation of Aspergillus niger is required for each elimination of resistance, and the transformation of Aspergillus niger is time-consuming and laborious

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Aspergillus niger gene knockout method
  • Aspergillus niger gene knockout method
  • Aspergillus niger gene knockout method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] The extraction of embodiment 1 Aspergillus niger genomic DNA

[0026] Inoculate Aspergillus niger spores into ME liquid medium (3% malt extract, 0.5% tryptone), culture at 250 r / min at 35°C for 48 hours, collect the balls with mirocloth, wash 3 times with sterile ultrapure water, and filter dry Moisture, quickly frozen in liquid nitrogen. The tissue was thoroughly ground by grinding with liquid nitrogen, and the filamentous fungal genome was extracted by QIAGEN DNeasyPlantMiniKit.

Embodiment 2

[0027] Example 2 Construction of cutting element and gene knockout expression cassette

[0028] 1) Construction of gene knockout expression cassette:

[0029] Using primer oahB5-F( GAGCTCGTTTAAAC TACCAAGGCCAGGCCGCAA) and oahB5-R ( GCGGCCGC CCGCCAGCAACCAATATTCAT) amplifies the fragment oahB5 of the upstream 2200bp of the oah gene from the Aspergillus niger genome, the 5' end of the fragment contains SacI and PmeI sites, and the 3' end of the fragment contains the NotI site; Utilize primer oahB3-F( ACTAGT ACAGAACACCCCTGATCGACAGT) and oahB3-R ( AAGCTT CCTGCTACAAATACATTGACCTC) amplifies the oahB3 fragment 2200bp downstream of the oah gene from the Aspergillus niger genome, and the two ends of the fragment contain SpeI and HindIII sites.

[0030] Primer PgpdB-F

[0031] ( GCGGCCGC ATAACTTCGTATAATGTATGCTATACGAAGTTATCCTTGTATCTCTACACACAGGCTCA) and hphB-R( ACTAGT CCGCGGTCGGCATCTACT) amplifies the complete gpdA promoter and hph half fragment from the pAN7-1 vector, named hph...

Embodiment 3

[0036] Preparation and transformation of embodiment 3 Aspergillus niger protoplast

[0037] Press 3×10 5 Inoculate the spores to ME liquid medium at a concentration of / ml, and culture overnight at 30°C and 200r / min. Collect mycospheres with mirocloth, and wash mycospheres with sterile water. A certain amount of lysozyme was weighed, dissolved with osmotic pressure stabilizer KMC, and sterilized by filtration with a sterile filter membrane. Weigh a certain amount of bacterial spheres, add them to the enzymatic hydrolysis solution, incubate with shaking at 37°C 100r / min for about 3 hours until the mycelium is completely digested into protoplasts, centrifuge at 1000rpm at 4°C for 10min, discard the supernatant, add the same volume of pre-cooled STC, Centrifuge at 1000 rpm at 4°C for 10 min, discard the supernatant, wash twice, add 100 μL STC, and mix well. Add 10 μL of linearized nucleic acid fragments and 330 μL PEG buffer to 100 μL of Aspergillus niger protoplasts, place on...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an aspergillus niger gene knockout method and belongs to the technical field of biotechnology. A shearing element and a gene knockout expression cassette are integrated in an aspergillus niger genome simultaneously, resistance genes are induced to be eliminated by inducible promoters later, and accordingly, resistance can be eliminated by transforming aspergillus niger once. The method can be used for knocking out multiple genes continuously; an effective method and a new concept are provided for metabolic transformation of aspergillus niger.

Description

technical field [0001] The invention relates to a gene knockout method of Aspergillus niger, which belongs to the field of biotechnology. Background technique [0002] Aspergillus niger is a filamentous fungus that widely exists in nature and has various phenotypes. It is one of the most important industrial production bacteria in the field of biotechnology industry. It is mainly used as a bioreactor to produce enzymes (amylases) that degrade polysaccharides. , pectinase and xylanase) and organic acids (such as citric acid). At the same time, as a genetic engineering host to produce protein and polypeptide products, compared with Escherichia coli and yeast, Aspergillus niger has the advantages of a glycosylation site more similar to that of mammals, a powerful protein secretion system, and a cheaper medium. It has been successfully reported that the accumulation of target products can be achieved by regulating the metabolism of Aspergillus niger through molecular modificati...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/80
Inventor刘龙陈坚堵国成
OwnerJIANGNAN UNIV