Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A kind of highly sensitive respiratory virus nucleic acid nasba amplification primer and detection method

A high-sensitivity, viral nucleic acid technology, applied in the field of biomedicine, can solve the problems of increasing the chance of contamination, time-consuming, and limiting wide application, etc., and achieve the effect of improving RNA amplification efficiency, improving detection sensitivity, and simple operation process

Active Publication Date: 2019-02-12
HANGZHOU JOINSTAR BIOTECH
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, this method needs to first reverse-transcribe the viral RNA into cDNA, and then perform the amplification reaction of the specific nucleic acid sequence, which increases the chance of contamination and limits the wide application of this technology in clinical testing.
The fourth category is gene chips, next-generation sequencing technology, and mass spectrometry. Although these advanced detection technologies have greatly improved sensitivity, they are time-consuming or expensive, and have many scientific research uses. They have not yet been widely used in clinical pathogen detection. application
It can be seen from this that the classic NASBA technology coupled with enzyme-labeled (fluorescent) probe hybridization method can only recognize the RNA sequence consistent with the template strand, and the detection process must use the enzyme-labeled (fluorescent) probe-coupled chromogenic technology, Increased the operational complexity of the method and the need for color development equipment, etc.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of highly sensitive respiratory virus nucleic acid nasba amplification primer and detection method
  • A kind of highly sensitive respiratory virus nucleic acid nasba amplification primer and detection method
  • A kind of highly sensitive respiratory virus nucleic acid nasba amplification primer and detection method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0081] Reagent composition (taking respiratory syncytial virus as an example)

[0082] (1) Primer

[0083] FP: AATTCTAATACGACTCACTATAGGGAGAAGGAAAGTCCTACAAAAAAATGC

[0084] RP: AATTCTAATACGACTCACTATAGGGAGAAGGATCTATCTCCTGCTGCTAAT 0.25ul each.

[0085] (2) NASBA Amplification Reagent

[0086] BA (buffer): 2ul

[0087] DA:dNTP 0.25ul

[0088] NA: NTP 0.5ul

[0089] DMSO: 0.25ul

[0090] EM (enzyme mix): AMV, RNAseH, T7 RNA polymerase, BSA 5.5ul

[0091] (3) NASBA product detection reagent

[0092] 1% agarose gel

Embodiment 2

[0093] Embodiment 2: NASBA detection process

[0094] (1) Amplification system: Add 1ul sample RNA template, 2ul BA, 0.25ul NA, 0.5ul DA, 0.25ul DMSO, 0.25ulFP, 0.25ul RP into a 0.2ml PCR amplification tube.

[0095] (2) Amplification process: Place the PCR amplification tube on the amplification instrument, heat it at 65° for 5 minutes, then cool it at 42° for 5 minutes; then add 5.5ul EM, and react at 42° for 60 minutes.

[0096] (3) Amplification product detection: Take 2ul of sample buffer and add it to the amplification product to terminate the reaction.

[0097] The amplified product was added to 1% agarose gel, and an electrophoresis standard was added to one of the sample wells. After electrophoresis at 100V for 10 minutes, the presence or absence of the target band was observed in an electrophoresis imager.

Embodiment 3

[0098] Embodiment 3: comparative experiment

[0099] Adopt the contrast of respiratory syncytial virus NASBA kit of the present invention and one-step PCR method to dilute the secondary standard of respiratory syncytial virus into 10 2 、10 4 -10 10 copy / ul. Use the kit of the present invention and one-step PCR to detect simultaneously.

[0100] (1) NASBA kit sensitivity test

[0101] NASBA amplification and detection were performed according to Example 2.

[0102] From attached figure 2 It can be seen that the NASBA kit of the present invention can successfully detect 10 2 Copy the sample of / ul.

[0103] (2) One-step PCR sensitivity and rigidity detection

[0104] A. One-step PCR reaction system: 2ul sample RNA template, 12.5ul 2*one-step SYBRRT-PCRbuffer, 1ul primeScript 1 step Enzyme Mix, 1ul FP, 1ul rp, 7.5ul RNase Freeddh 2 0.

[0105] B. One-step PCR reaction process: put the above PCR tube at 42° for 5 minutes and then enter the cycle without going, 95° for ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides novel high-sensitivity respiratory virus nucleic acid NASBA (nucleic acid sequence based amplification) primers. A respiratory virus conservative area is selected, and a promoter sequence capable of being recognized by T7 RNA (ribose nucleic acid) polymerase is formed at the 5' terminal of one of the synthesized primers. The invention further provides a novel high-sensitivity respiratory virus nucleic acid NASBA detection method. T7 RNA polymerase promoter sequences are added to the 5' terminals of the two primers complementary to two ends of a respiratory virus RNA sequence, so that when the primers enter a circulation phase, RNA sequences [RNA(+)] consistent with a template sequence can be synthesized, RNA sequences [RNA(-)] complementary to a template RNA sequence can be synthesized, and the detection sensitivity of viral nucleic acid is greatly improved; a throat swab sample of a patient can be directly used for amplification, a reverse transcription process is not required, and the operation time is saved.

Description

technical field [0001] The invention relates to the technical field of biomedicine, in particular to a gene amplification technology for respiratory virus detection, and more specifically to establish a high-sensitivity NASBA amplification technology for respiratory virus nucleic acid. Specifically, it includes a pair of respiratory virus-specific amplification primers, a NASBA amplification reaction system and a NASBA product detection system. Background technique [0002] Acute respiratory infection is one of the main causes of human morbidity and death. There are many types of pathogens that cause infection, including bacteria, viruses, mycoplasma and chlamydia, etc., especially viruses. Regardless of the etiology, the clinical symptoms and signs of respiratory tract infections are similar, while infections caused by different types of pathogens have completely different treatment methods, and the curative effects and course of the disease are also different. [0003] R...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/70C12Q1/6865C12N15/11
CPCC12Q1/6865C12Q1/701C12Q2531/143
Inventor 郑昭璟朱友杰耿娟李桃萍赵艳任杰张冉朱叶孙晋华周旭一
Owner HANGZHOU JOINSTAR BIOTECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products