D-acetylglucosamine deacetylase heterologous expression and application

A deacetylase and glucosamine technology, applied in the direction of microbial-based methods, hydrolase, recombinant DNA technology, etc., to achieve the effect of large industrialization potential, strong substrate specificity, and high reaction efficiency

Inactive Publication Date: 2016-01-27
NANJING AGRICULTURAL UNIVERSITY
View PDF2 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] However, the generation of D-acetylglucosamine from chitin and the regeneration of glucosamine are still in the research stage, and further practical experimental research is needed. In order to realize the large-scale production of this method, it is the direction we will work hard in the future

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • D-acetylglucosamine deacetylase heterologous expression and application
  • D-acetylglucosamine deacetylase heterologous expression and application
  • D-acetylglucosamine deacetylase heterologous expression and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0044] The acquisition of embodiment 1D-acetylglucosamine deacetylase gene:

[0045] (1) Dip a little Cyclobacterium marinum 1.5mL centrifuge tube with a pipette gun, add 500μl marine round bacteria DNA extraction solution (50mM Tris-base, 50mM sodium chloride, 500mM EDTA, 110% SDS, 1% Triton-X100 and 0.2mU / μl Proteinase K, pH8.0), inactivate proteinase K at 90°C after incubating at 55°C for 3 hours. Store at -20°C for later use.

[0046] (2) Obtain the target gene by PCR

[0047] Primers were designed according to the gene of D-acetylglucosamine deacetylase in GeneBank, with restriction endonuclease EcoRI and XhoI base sequences and protective bases at both ends of the primers. Synthesized by Nanjing GenScript Company:

[0048] EcoRIF: 5'CGGAATTCATGAATGCAGCACAAAAATTAG3'

[0049] XhoIR: 5'CCGCTCGAGTTAGTCTTTATATATTTTTTCCCT3'

[0050] The PCR program is: 95°C for 10 seconds, 55°C for 15 seconds, and 72°C for 1 minute, a total of 35 cycles. After the PCR reaction, run elect...

Embodiment 2

[0053] Expression of embodiment 2D-acetylglucosamine deacetylase coding gene in BL (DE21)

[0054] Extract the plasmid from the Escherichia coli Top10 cells carrying the recombinant plasmid obtained in Example 1, and transform it into the prepared competent cell BL21(DE3). Pick the recombinant Escherichia coli strain BL21 (DE3) into 5 ml of LB liquid medium containing kana antibiotics at 37° C. and shake at 250 rpm for overnight culture. Transfer to fresh LB (400ml) culture medium according to 1% inoculum size (v / v), culture at 37°C, shake at 250rpm until OD 600 ≈0.6-0.8, add the inducer IPTG to a final concentration of 1.0mM, culture at 25°C and 250rpm for 3 hours with shaking.

Embodiment 3

[0055] Example 3D-Purification of acetylglucosamine deacetylase

[0056] The bacterium solution of the D-acetylglucosamine deacetylase expressed in Example 2 was centrifuged at 4° C. at 4000 rpm for 20 min to collect the thalline, and 10 ml of lysis buffer (pH 7.550 mM sodium chloride; 50 mM Tris-HCl ; 1% Triton), 100 μl PMSF, resuspending the bacteria in the lysate, and breaking the cells in an ultrasonic breaker for 20 minutes. The broken cell lysate was centrifuged at 4000rpm for 20min at 4°C to collect the supernatant.

[0057] Since the N-terminal of the designed recombinant expression vector pET28a(+)-N-acetylglucosaminedeacetylase expression product has 6 consecutive histidines, it can be affinity-purified by an affinity chromatography column (Ni-NTA agarose gel). First equilibrate the column (pH8.0100mM sodium chloride 50mMTris-HCl) with an equilibrium solution, load the crude enzyme solution onto the column; use 10 times the volume of washing solution (pH8.0100mM sod...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention belongs to the field of biological engineering, and specifically discloses high-quality D-acetylglucosamine deacetylase heterologous expression and application. The amino acid sequence of the D-acetylglucosamine deacetylase is as shown in SEQNO. 1. Through enzymatic activity measurement and substrate specificity analysis, the D-acetylglucosamine deacetylase is strong in substrate specificity, and in the substrate for researches, D-acetylglucosamine (GlcNAc) and beta-bonded D-acetylglucosamine (GlcNAc) are deacetylated targetedly to generate D-glucosamine (GlcN) or beta-bonded glucosamine (GlcN). Recombinant D-acetylglucosamine deacetylase is expressed by use of genetic engineering cloning, the D-acetylglucosamine deacetylase can be strongly expressed, and high-quality D-acetylglucosamine deacetylase can be obtained.

Description

technical field [0001] The invention belongs to the field of bioengineering, and relates to the heterologous expression of high-quality D-acetylglucosamine deacetylase, the optimization of enzyme activity conditions and its application. Background technique [0002] Glucosamine (GlcN), also known as glucosamine, glucosamine or glucosamine, has important physiological significance in the body: it participates in liver and kidney detoxification, exerts anti-inflammatory, liver-protecting, anti-reactivity, and anti-hypoxic effects, and stimulates infant The proliferation of bifidobacteria in the intestinal tract, etc.; it also has different applications in the fields of food, agriculture and cosmetics. GlcN has such a wide range of uses, but there are few related products in China at present. [0003] Chitin is also called chitin. Chitin is widely distributed in the shells of shrimps, crabs, and insects. Its main constituent unit is N-acetylglucosamine (GlcNAc), which can be h...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N9/80C12N15/70C12N1/21C12P19/26C12R1/19
CPCC12N9/80C12P19/26C12N15/70C12N1/205C12R2001/19
Inventor弗戈迈·约瑟夫刘丽吕永梅
OwnerNANJING AGRICULTURAL UNIVERSITY