Tomato non-coding RNA gene LelncRNA1 and application thereof
A non-coding, genetic technology, applied in the field of plant genetic engineering, can solve the problems of limited important functions and unreported anti-viral disease functions, and achieve the effect of improving disease resistance
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0025] A tomato variety CLN2777A resistant to TYLCV was selected (Liu Tingli, Yang Mali, Liu Xiaoshuang, Pei Yanfei, Zhao Huijuan, Yang Yuwen, Chen Tianzi, Zhang Baolong. Functional analysis of a tomato gene LeFLS2 induced by TYLCV-induced up-regulation. Journal of Jiangsu Agricultural Science, 2014, 30(2) :376-380), when the tomato grows to the 3-4 leaf stage, the tomato leaves are quick-frozen in liquid nitrogen, ground in a mortar, and the total RNA is extracted with the RNA extraction kit (DP419) of Beijing Tiangen Company, and the total RNA is identified by electrophoresis 质量;根据番茄RNA-Seq数据(TianziChen,YuandaLv,TongmingZhao,NanLi,YuwenYang,WenguiYu,XinHe,TingliLiu,BaolongZhang.Comparativetranscriptomeprofilingofaresistantvs.susceptibletomato(Solanumlycopersicum)cultivarinresponsetoinfectionbytomatoyellowleafcurlvirus.PLoSOne,2013,8(11):e80816),发现一个EST During the process of TYLCV infecting tomato, the expression was up-regulated, and the 5'RACE primers were designed according ...
Embodiment 2
[0029] The primers JAGN920F and JAGN921R designed in Example 1 were used to carry out quantitative RT-PCR analysis to inoculate the expression of 0d, 6d, and 12d tomato leaf LelncRNA1 gene after inoculating TYLCV. The results showed that after inoculating TYLCV, as the inoculation time became longer, the expression of LelncRNA1 gene Gradually enhanced, the expression level of 12dLelncRNA1 gene was about 2 times of 0d after inoculation ( image 3), indicating that the expression of LelncRNA1 gene is related to TYLCV infection.
Embodiment 3
[0031] According to the full-length sequence SEQIDNO.1 of the tomato LelncRNA1 gene, primers JAGN2225FCGCGGATCCAGCAGCAAATCCAGCGACCCGAG and JAGN2226RCGGGGTACCGTTGAATAATATTTAAGTTCACATCAGCA were designed to introduce restriction endonuclease sites BamHI and KpnI respectively, and the pMD19-T:LelncRNA1 plasmid obtained in step 2 was used as a template for PCR amplification Finally, LelncRNA1 was cloned into the binary expression vector pCAMBIA2301 (snapgene), sequenced and identified to ensure that the reading frame of the coding region in the expression vector was correct, and the vector with correct sequencing was named: pCAMBIA2301:LelncRNA1.
[0032] The expression vector pCAMBIA2301:LelncRNA1 was transferred into Agrobacterium strain EHA105 (Second Laboratory Company), and transferred into Ben's Tobacco (Nicotianabenthamiana), after PCR and RT-PCR verification of the obtained transgenic plants ( Figure 4 ), the positive transgenic T1 generation plants grown to the 3-4 leaf s...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 