Recombinant plasmid capable of expressing soluble human papilloma virus 16 subtype L1 protein and expression method thereof
A human papilloma virus and recombinant plasmid technology, applied in the field of genetic engineering, can solve the problem of not using HPV16L1 to express cervical cancer vaccine, etc., and achieve the effects of increasing hemagglutination value, high activity and improving efficiency
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0064] The construction of the recombinant expression plasmid of embodiment 1 band SUMO tag
[0065] The recombinant expression plasmid with the SUMO tag of the present invention is rebuilt on the basis of the pET28a backbone, and the specific steps are as follows:
[0066] First, introduce the restriction endonuclease NcoI restriction endonuclease NcoI digestion site and 6*His-tag gene at the upstream 5' end of the SUMO gene, and introduce the restriction endonuclease BsaI restriction endonuclease BsaI restriction endonuclease restriction site at the downstream 3' end, using Sumo protease enzyme Special properties of the cutting site (the cutting site is GlyGly, which encodes the gene GG AGGT ), combined with the specificity of the BsaI restriction site, can achieve no residue cleavage of the N-terminus of the recombinantly expressed protein.
[0067] The BsaI restriction site is:
[0068] The sequence of the Sumo-tag tag gene is as follows:
[0069] CCATGGGTCATCACCATCA...
Embodiment 2
[0092] Cloning of embodiment 2HPV16L1 gene
[0093] 1. Design and synthesis of HPV16L1 gene sequence
[0094] The HPV16L1 gene sequence of the present invention is a DNA sequence optimized by codon preference in Escherichia coli, that is, a DNA sequence obtained by codon optimization and certain corrections to the optimal codon frequency, specifically as follows:
[0095] Firstly, the natural HPV16L1 gene is modified, and all its amino acids use the most frequently used codons to design a brand new HPV16L1 DNA sequence. The structure affects the translation efficiency and avoids some commonly used enzyme cutting sites. It is necessary to make some corrections to the optimal codon frequency, and finally obtain a brand new HPV16L1 DNA sequence, as follows:
[0096] ATGTCTCTGTGGCTGCCTTCTGAGGCCACTGTCTACCTGCCTCCTGTCCCAGTATCTAAGGTTGTAAGCACCGATGAATATGTTGCACGCACCAACATCTATTATCATGCAGGTACCTCCCGTCTGCTGGCAGTTGGTCATCCGTATTTTCCTATTAAAAAACCTAACAACAACAAAATCCTGGTTCCTAAAGTATCTGGTCTGCAATACCGTGTA...
Embodiment 3
[0109] Example 3 Construction of recombinant plasmid expressing soluble human papillomavirus 16 subtype L1 protein
[0110] The recombinant plasmid pET28-Sumo and the PCR amplification product (HPV16L1 gene) were subjected to double digestion with restriction endonucleases BsaI and XhoI respectively, and the specific reaction conditions were as follows:
[0111] The enzymatic digestion system is:
[0112] The total volume of the system is 50 μL, and the reaction conditions are 37° C. for 4 hours.
[0113] Subsequently, the double digestion products of the recombinant plasmid pET28-Sumo and the HPV16L1 gene were respectively recovered and ligated with T4 DNA ligase to obtain the recombinant plasmid II. The ligation system was as follows:
[0114]
[0115] The total reaction system is 20 μl, and the specific reaction conditions are: overnight connection at 16°C.
[0116] The recombinant plasmid II was transformed into Escherichia coli competent cells JM109 respectively, a...
PUM
Property | Measurement | Unit |
---|---|---|
molecular weight | aaaaa | aaaaa |
diameter | aaaaa | aaaaa |
molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap