Check patentability & draft patents in minutes with Patsnap Eureka AI!

Recombinant plasmid capable of expressing soluble human papilloma virus 16 subtype L1 protein and expression method thereof

A human papilloma virus and recombinant plasmid technology, applied in the field of genetic engineering, can solve the problem of not using HPV16L1 to express cervical cancer vaccine, etc., and achieve the effects of increasing hemagglutination value, high activity and improving efficiency

Active Publication Date: 2016-02-03
ZHENGZHOU UNIV +1
View PDF3 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0009] However, there is no report on the use of Sumo-labeled E. coli system to promote the expression of HPV16L1 and to prepare cervical cancer vaccines.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant plasmid capable of expressing soluble human papilloma virus 16 subtype L1 protein and expression method thereof
  • Recombinant plasmid capable of expressing soluble human papilloma virus 16 subtype L1 protein and expression method thereof
  • Recombinant plasmid capable of expressing soluble human papilloma virus 16 subtype L1 protein and expression method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0064] The construction of the recombinant expression plasmid of embodiment 1 band SUMO tag

[0065] The recombinant expression plasmid with the SUMO tag of the present invention is rebuilt on the basis of the pET28a backbone, and the specific steps are as follows:

[0066] First, introduce the restriction endonuclease NcoI restriction endonuclease NcoI digestion site and 6*His-tag gene at the upstream 5' end of the SUMO gene, and introduce the restriction endonuclease BsaI restriction endonuclease BsaI restriction endonuclease restriction site at the downstream 3' end, using Sumo protease enzyme Special properties of the cutting site (the cutting site is GlyGly, which encodes the gene GG AGGT ), combined with the specificity of the BsaI restriction site, can achieve no residue cleavage of the N-terminus of the recombinantly expressed protein.

[0067] The BsaI restriction site is:

[0068] The sequence of the Sumo-tag tag gene is as follows:

[0069] CCATGGGTCATCACCATCA...

Embodiment 2

[0092] Cloning of embodiment 2HPV16L1 gene

[0093] 1. Design and synthesis of HPV16L1 gene sequence

[0094] The HPV16L1 gene sequence of the present invention is a DNA sequence optimized by codon preference in Escherichia coli, that is, a DNA sequence obtained by codon optimization and certain corrections to the optimal codon frequency, specifically as follows:

[0095] Firstly, the natural HPV16L1 gene is modified, and all its amino acids use the most frequently used codons to design a brand new HPV16L1 DNA sequence. The structure affects the translation efficiency and avoids some commonly used enzyme cutting sites. It is necessary to make some corrections to the optimal codon frequency, and finally obtain a brand new HPV16L1 DNA sequence, as follows:

[0096] ATGTCTCTGTGGCTGCCTTCTGAGGCCACTGTCTACCTGCCTCCTGTCCCAGTATCTAAGGTTGTAAGCACCGATGAATATGTTGCACGCACCAACATCTATTATCATGCAGGTACCTCCCGTCTGCTGGCAGTTGGTCATCCGTATTTTCCTATTAAAAAACCTAACAACAACAAAATCCTGGTTCCTAAAGTATCTGGTCTGCAATACCGTGTA...

Embodiment 3

[0109] Example 3 Construction of recombinant plasmid expressing soluble human papillomavirus 16 subtype L1 protein

[0110] The recombinant plasmid pET28-Sumo and the PCR amplification product (HPV16L1 gene) were subjected to double digestion with restriction endonucleases BsaI and XhoI respectively, and the specific reaction conditions were as follows:

[0111] The enzymatic digestion system is:

[0112] The total volume of the system is 50 μL, and the reaction conditions are 37° C. for 4 hours.

[0113] Subsequently, the double digestion products of the recombinant plasmid pET28-Sumo and the HPV16L1 gene were respectively recovered and ligated with T4 DNA ligase to obtain the recombinant plasmid II. The ligation system was as follows:

[0114]

[0115] The total reaction system is 20 μl, and the specific reaction conditions are: overnight connection at 16°C.

[0116] The recombinant plasmid II was transformed into Escherichia coli competent cells JM109 respectively, a...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
diameteraaaaaaaaaa
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention discloses a recombinant plasmid capable of expressing a soluble human papilloma virus 16 subtype L1 protein and an expression method thereof. The recombinant plasmid is constructed by inserting a human papilloma virus 16 subtype L1 gene and an SUMO label gene into an expression plasmid. According to the recombinant plasmid disclosed by the invention, the HPV16 L1 gene is optimized, so that the HPV16 L1 gene is more applicable to efficient expression of a target protein in an escherichia coli host; meanwhile, an Sumo label expression system is initially applied to fusion expression in escherichia coli, and the solubility of the target protein is further enhanced, so that the expressed target protein has higher activity. The expression method disclosed by the invention has the advantages that the target protein solubility expression efficiency is obviously improved, the product property is uniform and stable, the target protein expression quantity in a supernatant of a fermented disrupted bacterium liquid can reach 70Mug / ml, and the numerical value is obviously higher than yields of the target protein in other prokaryotic expression systems, so that the industrial production requirement is met.

Description

technical field [0001] The invention relates to a recombinant plasmid expressing soluble human papillomavirus 16 subtype L1 protein, a construction method, a recombinant engineering bacterium and an expression method thereof, and belongs to the technical field of genetic engineering. Background technique [0002] Human papillomavirus (Human Papillomavirus, HPV) is a kind of double-stranded small molecule DNA virus with strict species specificity, mainly infecting human skin and mucous membrane tissue, causing proliferative lesions of epithelial tissue in corresponding parts. In 1977, Laverty (Laverty, C.R., Russell, P.etal.1977) observed the presence of HPV particles in cervical cancer tissue under electron microscopy. In 1981, ZurHausen (HzurHausen.etal.1981) put forward the hypothesis that HPV may be related to the pathogenesis of cervical cancer . Since then, this view has been confirmed by more and more experiments. The incidence of cervical cancer is directly related ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/70C12N15/37C12N15/66C12N1/21A61K39/12A61P31/20C12R1/19
Inventor 王爱萍张改平陈玉梅王娟刘运超周景明祁艳华刘东民刘燕凯刘文英栗宁蒋敏
Owner ZHENGZHOU UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More