Thermophilic alkaline pectin lyase gene, engineering bacterium, thermophilic alkaline pectin lyase and application thereof
A technology of pectin lyase and genetically engineered bacteria, which is applied in the field of bioengineering, can solve the problems of few reports on thermophilic pectinase, and achieve the effect of increasing the fermentation capacity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0035] Example 1: Construction of thermophilic engineering bacteria and expression of enzymes
[0036] (1) Primer design and acquisition of thermophilic alkaline pectin lyase gene PelC by PCR method
[0037] Using the genome of Fusobacterium thermofusiformis CaldicellulosiruptorbesciiDSM6725 as a template, design primers, amplify PelC gene by PCR method, carry out agarose gel electrophoresis to the amplified product, recover and purify 1300bp, sequencing shows that the size of this fragment is 1305bp, and its sequence is as SEQ ID NO .1 shown.
[0038]The sequences of the upstream primers are as follows:
[0039] Upstream Primer 1:
[0040] 5'GGAATTC CATATG ATTGGGTTGCGTAATGAAGTTGCAAAGGCAGC3'
[0041] (The underlined base is the recognition sequence of NdeI digestion);
[0042] The sequences of the downstream primers are as follows:
[0043] Downstream primer 2:
[0044] 5'CCG CTCGAG TCAGTGGTGGTGGTGGTGGTGCTCGAGGTATTGATG3'
[0045] (The bases underlined are the recogni...
Embodiment 2
[0062] Embodiment 2: Characteristic of recombinant thermophilic alkaline pectin lyase
[0063] The enzyme activity assay method of thermophilic alkaline pectin lyase described in embodiment 1 is specifically as follows:
[0064] Substrate preparation: Weigh 0.2g of polygalacturonic acid and place it in a 100mL beaker, add about 80mL of 50mM Gly and stir to dissolve it, adjust the pH to 9.5 with 1mol / L NaOH, and dilute the solution to 100mL with a volumetric flask , dubbed 0.2% (w / v) of the substrate.
[0065] Control group: add 100μL, 0.8mM, CaCl to 800μL substrate 2 , preheat at 70°C for 1 min, add 100 μL, 20 mM, pH 8.0 Tris-HCl, and measure the absorbance at 235 nm within 2 min;
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 