Thermophilic alkaline pectin lyase gene, engineering bacterium, thermophilic alkaline pectin lyase and application thereof

A technology of pectin lyase and genetically engineered bacteria, which is applied in the field of bioengineering, can solve the problems of few reports on thermophilic pectinase, and achieve the effect of increasing the fermentation capacity

Inactive Publication Date: 2016-03-30
JILIN UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] At present, pectin lyases are mainly alkaline enzymes, and most of them are normal temperature enzymes, and there are few thermophilic enzymes. So far, there are many reports on thermophilic cellulase, but few reports on thermophilic pectinase

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Thermophilic alkaline pectin lyase gene, engineering bacterium, thermophilic alkaline pectin lyase and application thereof
  • Thermophilic alkaline pectin lyase gene, engineering bacterium, thermophilic alkaline pectin lyase and application thereof
  • Thermophilic alkaline pectin lyase gene, engineering bacterium, thermophilic alkaline pectin lyase and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Example 1: Construction of thermophilic engineering bacteria and expression of enzymes

[0036] (1) Primer design and acquisition of thermophilic alkaline pectin lyase gene PelC by PCR method

[0037] Using the genome of Fusobacterium thermofusiformis CaldicellulosiruptorbesciiDSM6725 as a template, design primers, amplify PelC gene by PCR method, carry out agarose gel electrophoresis to the amplified product, recover and purify 1300bp, sequencing shows that the size of this fragment is 1305bp, and its sequence is as SEQ ID NO .1 shown.

[0038]The sequences of the upstream primers are as follows:

[0039] Upstream Primer 1:

[0040] 5'GGAATTC CATATG ATTGGGTTGCGTAATGAAGTTGCAAAGGCAGC3'

[0041] (The underlined base is the recognition sequence of NdeI digestion);

[0042] The sequences of the downstream primers are as follows:

[0043] Downstream primer 2:

[0044] 5'CCG CTCGAG TCAGTGGTGGTGGTGGTGGTGCTCGAGGTATTGATG3'

[0045] (The bases underlined are the recogni...

Embodiment 2

[0062] Embodiment 2: Characteristic of recombinant thermophilic alkaline pectin lyase

[0063] The enzyme activity assay method of thermophilic alkaline pectin lyase described in embodiment 1 is specifically as follows:

[0064] Substrate preparation: Weigh 0.2g of polygalacturonic acid and place it in a 100mL beaker, add about 80mL of 50mM Gly and stir to dissolve it, adjust the pH to 9.5 with 1mol / L NaOH, and dilute the solution to 100mL with a volumetric flask , dubbed 0.2% (w / v) of the substrate.

[0065] Control group: add 100μL, 0.8mM, CaCl to 800μL substrate 2 , preheat at 70°C for 1 min, add 100 μL, 20 mM, pH 8.0 Tris-HCl, and measure the absorbance at 235 nm within 2 min;

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a thermophilic alkaline pectin lyase gene, an engineering bacterium, thermophilic alkaline pectin lyase and application thereof and belongs to the technical field of biological engineering. The preservation number of the engineering bacterium is CGMCC No.11460, the engineering bacterium is named as Escherichia coli through classification, the depository authority is the General Microbiology Center of China Committee for Culture Collection of Microorganisms, and the preservation date is September 29, 2015. The invention mainly discloses the thermophilic alkaline pectin lyase, the optimum reaction temperature is 70 DEG C, the optimal Ca2+ concentration is 0.8 mM, a substrate is 0.2% (w / v) polygalacturonic acid, and pH is 9.5. The specific activity of the lyase is 900 U / mg under the optimal conditions that the pH is 9.5, the Ca2+ concentration is 0.8 mM and the temperature is 70 DEG C; heat preservation is performed at the temperature of 70 DEG C, and a half-life period is 6 h; after nickel column purification treatment is performed, CbPelC can be up to 50 mg / L (1 L fermented liquid). The heat resistance and yield of the thermophilic alkaline pectin lyase are remarkably improved, the thermophilic alkaline pectin lyase more adapts to the modern industrial production requirements, and an effective method is provided for industrial mass production of the alkaline pectinase.

Description

technical field [0001] The invention belongs to the technical field of bioengineering, and in particular relates to a thermophilic alkaline pectin lyase gene, engineering bacteria, thermophilic alkaline pectin lyase and the application of the enzyme in degrading pectin substances. Background technique [0002] Pectin substances are mainly composed of polygalacturonic acid (GalA), and the side chains often contain trehalose, rhamnose, arabinose, etc., which are widely present in primary plant cell walls. [0003] Pectinase is a general term for a series of enzymes that decompose pectin substances, and is widely distributed in higher plants and microorganisms. During the process of plant maturation, pectinase makes the plant cell wall softer, and also plays an important role in the balance of plant tissue corruption and regeneration. Pectinases can be divided into two categories according to their mode of action, namely esterases and depolymerases, and depolymerases are furth...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/60C12N9/88C12N1/21C12N15/70C12R1/19
CPCC12N9/88C12Y402/0201
Inventor张作明李海超张静李正强于擎
OwnerJILIN UNIV