Alkaline-lipase-producing Aspergillus niger mutant strain

A technology of mutant strain, Aspergillus niger, applied in the field of genetic engineering, can solve the problems of late alkaline lipase, lack of competitiveness and high production cost

Pending Publication Date: 2016-04-06
QINGDAO VLAND BIOTECH GRP
View PDF5 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Domestic research on alkaline lipase started late, and there is a big gap with foreign advanced technologies in terms of alkaline lipase fermentation strains, extraction process, enzyme activity, and granzyme preparation technology, especially the production cost of the product Much higher than similar foreign products, lack of competitiveness, so it is urgent to develop high-yielding strains of alkaline lipase to promote the wide application of alkaline lipase

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Alkaline-lipase-producing Aspergillus niger mutant strain
  • Alkaline-lipase-producing Aspergillus niger mutant strain
  • Alkaline-lipase-producing Aspergillus niger mutant strain

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0015] The acquisition of embodiment 1 alkaline lipase gene

[0016] According to the gene sequence in the public gene database, the alkaline lipase gene LipN (sequence is SEQ ID NO: 2) was synthesized by Shanghai Jierui Company, and the amino acid sequence encoded by it is SEQ ID NO: 1.

[0017] PCR primers and reaction conditions are as follows:

[0018] Primer 1 (F): ATGCGGTCCTCCCTGGTGCTG

[0019] Primer 2 (R): TCACAGACAGGTGCCGATCAG

[0020] The reaction conditions were: denaturation at 94°C for 5 minutes; then denaturation at 94°C for 30 s, renaturation at 56°C for 30 s, extension at 72°C for 45 s, and after 30 cycles, incubation at 72°C for 10 min. The results of agarose electrophoresis showed that the size of the LipN gene was 876bp.

Embodiment 2

[0021] Embodiment 2 recombinant vector construction

[0022] The alkaline lipase gene was amplified by PCR, and XbaI sites were introduced at both ends of the primers. The primer sequences are as follows:

[0023] Primer 3 (F): GC TCTAGA ATGCGGTCCTCCCTGGTGCTG

[0024] Primer 4 (R): GC TCTAGA TCACAGACAGGTGCCGATCAG

[0025] The PCR reaction conditions were: denaturation at 94°C for 5 minutes; then denaturation at 94°C for 30 seconds, renaturation at 56°C for 30 seconds, extension at 72°C for 45 seconds, and after 30 cycles, incubation at 72°C for 10 minutes. The results of agarose gel electrophoresis showed that the LipN gene was a fragment with a size of 876bp.

[0026] The alkaline lipase LipN fragment obtained above and the expression vector pGAU were subjected to single digestion with restriction endonuclease XbaI respectively, and the digestion conditions were as follows:

[0027]

[0028] Enzyme digestion treatment in water bath at 37°C for 2 hours, after electr...

Embodiment 3

[0031] The recombinant expression of embodiment 3 alkaline lipase LipN

[0032] Protoplast preparation: inoculate Aspergillus niger host Su2-1 on PDA+U plates, and culture at 30°C for 5-7d. Bacterial blocks with a size of 2cm×2cm were cut out, inoculated into 100ml liquid PDA+U medium, and cultured at 30°C for 24h to grow mycelia for transformation. After filtering the grown mycelia, resuspend with 20ml of 1.2M magnesium sulfate solution, and add 0.2g of lysozyme. Cultivate at 30°C and 100rpm for 2-3h. The lysed hyphae were filtered with two layers of lens paper, and centrifuged at 3000rpm for 10min to obtain protoplasts.

[0033] Transformation: the protoplasts were washed twice with 1.2M sorbitol solution, and then resuspended with an appropriate amount of sorbitol solution to make the protoplast concentration reach 10 8 . Add 10ul prepared plasmid to 200ul protoplasts, add 50ul 25% PEG6000, ice-bath for 20min, then add 2ml25% PEG6000 and place at room temperature for 5m...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
degree of polymerizationaaaaaaaaaa
Login to View More

Abstract

The invention aims to provides an alkaline-lipase-producing Aspergillus niger mutant strain which is prepared by the following steps: transforming an alkaline lipase gene into an Aspergillus niger host strain to construct an Aspergillus niger engineering strain capable of efficiently expressing alkaline lipase; and knocking out the amylase gene of the host strain by gene knock-out means, and screening to obtain the mutant strain with obviously enhanced alkaline lipase yield. The collection number of the mutant Aspergillus niger strain is CCTCC NO:M2015761. The alkaline lipase activity of the mutant strain Aspergillus niger Su-12 reaches 15766 u / ml, and the protein expression level is 5.4 g / L, which are respectively enhanced by 56.3% and 18.9% as compared with the strain before mutation, thereby being beneficial to wide application of the enzyme.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and in particular relates to a mutant strain of Aspergillus niger producing alkaline lipase. technical background [0002] Lipase is a class of enzymes with a variety of catalytic capabilities, which can catalyze the hydrolysis, alcoholysis, esterification, transesterification and reverse synthesis of triacylglycerides and other water-insoluble esters. It also shows some other enzyme activities, such as phospholipase, lysophospholipase, cholesterol esterase, acyl peptide hydrolase activity and so on. Lipase has a wide range of applications and has become the third largest industrial enzyme on the market. Lipase can catalyze reactions such as lipolysis, transesterification, and ester synthesis, and is widely used in industries such as feed additives, oil processing, food, medicine, and daily chemicals. [0003] Alkaline lipase is a lipase that is hydrolyzed under alkaline conditions....

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N1/15C12N9/20C12N9/30C12R1/685
CPCC12N9/20C12N9/242C12Y301/01003
Inventor徐晓东刘文瑶张珍珍徐娟
OwnerQINGDAO VLAND BIOTECH GRP