A treatment method for phosphorus-containing sewage
A sewage treatment method and sewage technology, applied in water/sewage treatment, biological water/sewage treatment, water/sewage multi-stage treatment, etc., can solve the problem of unsatisfactory treatment capacity and treatment effect, secondary pollution, and large floor space and other problems, to achieve the effect of good commercial utilization value and good degradability
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0023] Example 1 Sewage treatment method
[0024] An efficient sewage treatment method, characterized in that it includes the following process steps:
[0025] The quality of the sewage treated is as follows: CODcr450mg / L, BOD5150mg / L, SS≤200mg / L, NH3-N≤130mg / L, T-P≤100mg / L, pH=6.5-9.0.
[0026] (1) Pretreatment: The sewage is sent to the filter tank, where the original phosphorus content is to remove large particles and fiber impurities, and then sent to the grit tank to remove sand with a specific gravity of 2-3g / cm3 and a particle size of 0.2mm or more , Sent to the conditioning tank;
[0027] (2) Biochemical treatment: the sewage is introduced into the anoxic tank in the denitrification process, the hydraulic retention time is controlled for 8-12 hours, the dissolved oxygen is controlled to be less than 0.6mg / L, BOD is removed, and the nitrogen in NO3- is converted into nitrogen at the same time; The sewage from the anoxic tank is introduced into the anaerobic tank, the hydraulic...
Embodiment 2
[0033] Example 2 Construction of genetically engineered phosphorus accumulating bacteria
[0034] According to the primer design using DNAMAN software, BamHI and SalI restriction sites were added respectively. The forward primer sequence is: ATGTCGCAACTCAATTCCAA; the reverse primer sequence is: GGAGTGCAGCTGTACGGGGTC.
[0035] Amplification was performed to obtain the target fragment, and the Qujjl-1 gene was obtained by PCR amplification. The fragment size was about 1200 bp. Through sequencing, it was found that the amplification was correct.
[0036] The corresponding 24D / V, 60Q / F, 122Q / G, 153E / S, 183N / G, 199I / A, 236A / G, 253P / A, 309F / G, 367S / P, 373D / G mutations were made by multiple PCR The sites are respectively introduced into the coding gene sequence (refer to the preparation method of the prior art to obtain). Thus, different mutant genes were obtained, which were loaded into the expression vector PWB980, and the successfully verified recombinant plasmids were transformed into ...
Embodiment 3
[0037] Example 3 Verification of Dephosphorization Effect of Phosphorus Accumulating Bacteria Genetically Engineered Bacteria
[0038] According to the method of Example 1, the corresponding sewage treatment experiment was carried out, and different recombinant bacteria were used to carry out the phosphorus accumulation reaction. The experiment found that 24D / V, 60Q / F, 122Q / G, 153E / S, 183N / G, 199I / A, 236A / G, 253P / A, 309F / G, 367S / P, 373D / G these mutants all have a significantly enhanced effect compared to the original bacteria, while the 219N / S bacteria showed no enhancement Polyphosphate effect. The total treatment time is not more than 3 days, and the results are as follows: the sewage is the same batch of sewage, so as to ensure the same conditions.
[0039]
[0040] It can be seen that, with the method of this application, the efficiency of 3d dephosphorization is higher than that of the prior art. Therefore, it can be used for large-scale sewage treatment. And it also has a...
PUM
| Property | Measurement | Unit |
|---|---|---|
| particle diameter | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More