Detection method and detection kit of mycotoxin deoxynivalenol
A technology of deoxynivalenol and fusalenol nucleic acid, which is applied in biological testing, biochemical equipment and methods, measuring devices, etc., can solve the problem of complex preparation process of DON, high price, easy inactivation of biochemical reagents, etc. It can eliminate the interference of background fluorescence and improve the detection sensitivity and accuracy.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0029] A kit for detecting mycotoxin deoxynivalenol, comprising: deoxynivalenol nucleic acid aptamer DONApt, single-stranded signal probe ssDNA, DNA amplification system, exonuclease III, silver ion Restoration of the detection system. DONApt is 5'-GCATCACTACAGTCATTACG CATCGTAGGGGGGATCGTTA AGGAAGTGCCCGGAGGCGGTATCGTGTGAAGTGC-3'. The single-stranded signal probe ssDNA is 5'-CCCCCCACACCCGATCCCCCCGCACTTCACACGATA-3'. DNA amplification system includes deoxygenated mononucleotide triphosphate mixture dNTP solution, Phi29 DNA polymerase, NH 4 F-NaCl solution and amplification buffer solution, the amplification buffer solution consists of Tris-HCl, MgCl 2 , (NH 4 ) 2 SO 4 composition. The exonuclease is ExoIII. The silver ion reduction detection system comprises sodium citrate solution and reducing agent vitamin C solution.
Embodiment 2
[0031] A method for detecting mycotoxin deoxynivalenol, the specific operation process is as follows:
[0032] Heat the Tris-HCl (50mM, pH 7.5) solution of the deoxynivalenol nucleic acid aptamer DONApt and the Tris-HCl solution of the single-stranded signal probe ssDNA at 90°C for 5 minutes, and quickly place it in an ice bath 5 minutes, remove and store at room temperature for later use.
[0033] Take 40 μL of the DONApt solution containing 3.0 μmol of deoxynivalenol nucleic acid aptamer and 40 μL of 3.0 μmol of signal probe ssDNA solution that have been treated above, respectively, and place them in a 2ml centrifuge tube, and perform hybridization reaction at 37°C for 1 hour; follow the above method Prepare several hybridization solutions, and then add 5 μL of deoxynivalenol with a concentration of 0 to 1000 ng / mL to the above hybridization solution, so that the concentration (DON concentration calculated when the volume is 470 μL) is 0 ng / mL, 0.001ng / mL, 0.005ng / mL, 0.01n...
Embodiment 3
[0037] (1) Sample processing
[0038] Flour sample 1 was purchased from a supermarket, and the background DON value was 0.927mg / Kg. The flour used in Example 3 was all flour sample 1; the DON recovery was measured in the flour sample.
[0039] Take nine 10mL clean small beakers, numbered A1, A2, A3, B1, B2, B3, C1, C2, and C3; accurately weigh 3 copies of 0.1g flour samples, and place them in the beakers numbered A1, A2, and A3 respectively. Then add 15 μL of DON solution with a concentration of 30 μg / mL to the beakers numbered A1, A2, and A3 respectively; then accurately weigh 3 parts of 0.25 g flour samples, and place them in the beakers numbered B1, B2, and B3 respectively Then add 15 μL of DON solution with a concentration of 15 μg / mL to B1, B2 and B3 respectively; also accurately weigh 3 parts of 0.5 g flour samples and place them in beakers numbered C1, C2 and C3 respectively. Then add 15 μL of DON solution with a concentration of 5 μg / mL to the numbered C1, C2 and C3 r...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More