Rice cadmium-tolerant gene OsGSTU5, encoding protein thereof and application of rice cadmium-tolerant gene OsGSTU5
A cadmium-resistant rice technology, which is applied in the field of biotechnology and crop genetic engineering, can solve the problems of derivation and understanding, and achieve the effects of reducing enrichment, improving cadmium-tolerant ability, and deepening understanding
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0028] Example 1 Analysis of cadmium resistance in yeast of gene OsGSTU5
[0029] Step 1. Design of primers
[0030] According to the whole genome sequence of rice variety Nipponbare (Oryzasativa Lcv. Nipponbare) provided by NCBI, amplification primers were designed according to the coding region (CDS) sequence of rice gene OsGSTU5, and restriction sites were added to the primers.
[0031] Specifically designed primers are: forward primer (SEQIDNO: 3) with NcoI at the 5' end, restriction site (CCATGG), reverse primer (SEQ ID NO: 4) with BamHI at the 5' end, restriction site (GGATCC), The primer sequences are as follows:
[0032]Forward primer: CCATGGATGGCGGACGAGGTGGTGCTCCNcoI
[0033] Reverse primer: GGATCCCTTGGCGCCAAACTTGGCCTTGBamHI
[0034] Step 2 Acquisition of gene OsGSTU5
[0035] Using rice cDNA as a template, the OsGSTU5 gene was amplified using the above-mentioned forward primer and reverse primer. The enzyme used for cloning was HIFI high-fidelity polymerase (purc...
Embodiment 2
[0056] The acquisition of the overexpression strain of embodiment 2 gene OsGSTU5
[0057] 1.1 Construction of overexpression vector of gene OsGSTU5
[0058] Step 1. Design of primers
[0059] According to the whole genome sequence of rice variety Nipponbare (Oryzasativa Lcv. Nipponbare) provided by NCBI, amplification primers were designed according to the CDS sequence of rice gene OsGSTU5, and restriction sites were added to the primers.
[0060] The overexpression vector was constructed using pCAMBIA1300, which was transformed by the inventors of the present invention, and the entire coding frame was driven by the corn Ubiquitin gene promoter and fused with FLAG tags.
[0061] Specifically designed primers are: forward primer (SEQIDNO:5) 5' end band restriction site HindIII (AAGCTT), reverse primer (SEQ ID NO: 6) 5' end band restriction site KpnI (GGTACC), primer sequence as follows:
[0062] Forward primer: AAGCTTATGGCGGACGAGGTGGTGCTCCHindIII
[0063] Reverse primer: GG...
Embodiment 3
[0087] Example 3 Obtaining of Targeted Knockout Strain of Gene OsGSTU5
[0088] 1.1 Construction of knockout vector
[0089] According to the whole genome sequence of the rice variety Nipponbare (OryzasativaLcv.Nipponbare) provided in NCBI, and according to the sequence of the rice gene OsGSTU5, primers for the target site KO (SEQ ID NO: 11) were designed on the exon of the gene, and the design of the target site Note that the PAM sequence at the last site is required to be NGG, and the primer sequence is as follows (SEQ ID NO:12-13):
[0090] KOFP: GGCAGCAGGCCAAGAGGGACATGG
[0091] KORP:AAACCCATGTCCCCCTTGGCCTGC
[0092] After the primers are fully dissolved, anneal the primers according to the system in Table 1.
[0093] Table 1 Primer annealing system
[0094]
[0095] Reaction conditions: 37°C, 1h.
[0096] Add 2.5ul 1M NaCl, 95°C, 5s. Turn off the incubator and let it anneal naturally for 2-3 hours. Add 450 uL of ultrapure water to make the final probe concentrat...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com