Unlock instant, AI-driven research and patent intelligence for your innovation.

Rice cadmium-tolerant gene OsGSTU5, encoding protein thereof and application of rice cadmium-tolerant gene OsGSTU5

A cadmium-resistant rice technology, which is applied in the field of biotechnology and crop genetic engineering, can solve the problems of derivation and understanding, and achieve the effects of reducing enrichment, improving cadmium-tolerant ability, and deepening understanding

Inactive Publication Date: 2016-07-13
RICE RES ISTITUTE ANHUI ACAD OF AGRI SCI
View PDF2 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

GSTs family proteins are a super family that widely exists in the cytosol, but studies have shown that the function of a GST protein cannot be deduced based on the sequence similarity between the protein and other members of the family, and the functions of these GSTs family proteins are diverse

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Rice cadmium-tolerant gene OsGSTU5, encoding protein thereof and application of rice cadmium-tolerant gene OsGSTU5
  • Rice cadmium-tolerant gene OsGSTU5, encoding protein thereof and application of rice cadmium-tolerant gene OsGSTU5
  • Rice cadmium-tolerant gene OsGSTU5, encoding protein thereof and application of rice cadmium-tolerant gene OsGSTU5

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] Example 1 Analysis of cadmium resistance in yeast of gene OsGSTU5

[0029] Step 1. Design of primers

[0030] According to the whole genome sequence of rice variety Nipponbare (Oryzasativa Lcv. Nipponbare) provided by NCBI, amplification primers were designed according to the coding region (CDS) sequence of rice gene OsGSTU5, and restriction sites were added to the primers.

[0031] Specifically designed primers are: forward primer (SEQIDNO: 3) with NcoI at the 5' end, restriction site (CCATGG), reverse primer (SEQ ID NO: 4) with BamHI at the 5' end, restriction site (GGATCC), The primer sequences are as follows:

[0032]Forward primer: CCATGGATGGCGGACGAGGTGGTGCTCCNcoI

[0033] Reverse primer: GGATCCCTTGGCGCCAAACTTGGCCTTGBamHI

[0034] Step 2 Acquisition of gene OsGSTU5

[0035] Using rice cDNA as a template, the OsGSTU5 gene was amplified using the above-mentioned forward primer and reverse primer. The enzyme used for cloning was HIFI high-fidelity polymerase (purc...

Embodiment 2

[0056] The acquisition of the overexpression strain of embodiment 2 gene OsGSTU5

[0057] 1.1 Construction of overexpression vector of gene OsGSTU5

[0058] Step 1. Design of primers

[0059] According to the whole genome sequence of rice variety Nipponbare (Oryzasativa Lcv. Nipponbare) provided by NCBI, amplification primers were designed according to the CDS sequence of rice gene OsGSTU5, and restriction sites were added to the primers.

[0060] The overexpression vector was constructed using pCAMBIA1300, which was transformed by the inventors of the present invention, and the entire coding frame was driven by the corn Ubiquitin gene promoter and fused with FLAG tags.

[0061] Specifically designed primers are: forward primer (SEQIDNO:5) 5' end band restriction site HindIII (AAGCTT), reverse primer (SEQ ID NO: 6) 5' end band restriction site KpnI (GGTACC), primer sequence as follows:

[0062] Forward primer: AAGCTTATGGCGGACGAGGTGGTGCTCCHindIII

[0063] Reverse primer: GG...

Embodiment 3

[0087] Example 3 Obtaining of Targeted Knockout Strain of Gene OsGSTU5

[0088] 1.1 Construction of knockout vector

[0089] According to the whole genome sequence of the rice variety Nipponbare (OryzasativaLcv.Nipponbare) provided in NCBI, and according to the sequence of the rice gene OsGSTU5, primers for the target site KO (SEQ ID NO: 11) were designed on the exon of the gene, and the design of the target site Note that the PAM sequence at the last site is required to be NGG, and the primer sequence is as follows (SEQ ID NO:12-13):

[0090] KOFP: GGCAGCAGGCCAAGAGGGACATGG

[0091] KORP:AAACCCATGTCCCCCTTGGCCTGC

[0092] After the primers are fully dissolved, anneal the primers according to the system in Table 1.

[0093] Table 1 Primer annealing system

[0094]

[0095] Reaction conditions: 37°C, 1h.

[0096] Add 2.5ul 1M NaCl, 95°C, 5s. Turn off the incubator and let it anneal naturally for 2-3 hours. Add 450 uL of ultrapure water to make the final probe concentrat...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a rice cadmium-tolerant gene OsGSTU5, a coding protein thereof and application of the rice cadmium-tolerant gene OsGSTU5.The rice cadmium-tolerant gene OsGSTU5 contains sequences shown as SEQ ID NO:1 in sequence tables or derivatives of the sequences.Amino acid sequences of the encoding protein of the rice cadmium-tolerant gene OsGSTU5 are shown as SEQ ID NO:2 in the sequence tables.The rice cadmium-tolerant gene OsGSTU5, the encoding protein and the application have the advantages that glutathione (GSH) can be chelated with cadmium under the catalytic effects of glutathione S-transferase (GSTs) of the encoding expression protein of the rice cadmium-tolerant gene OsGSTU5, cadmium metabolism and isolation can be promoted, and accordingly the cadmium-tolerant capacity of plants can be improved; rice over-expression strains of the rice cadmium-tolerant gene OsGSTU5 are constructed, so that the cadmium stress tolerance capacity of the rice plants can be improved; physiological characteristics and regulation and control mechanisms of the rice cadmium-tolerant gene OsGSTU5 are researched, so that gene resources and a theoretical basis can be provided for research on physiological functions and regulation and control mechanisms of the plants under cadmium stress, and gene resources can be provided for research on functions of GSTs protein super-families.

Description

technical field [0001] The invention relates to the technical fields of biotechnology and crop genetic engineering. Specifically, the present invention relates to a rice cadmium-tolerant gene OsGSTU5, its encoded protein and its application. Background technique [0002] Cadmium (Cd) is a heavy metal element, which is a non-essential element for plant growth and development. Industrial pollution has caused the cadmium content in farmland soil to seriously exceed the standard. Soil cadmium pollution seriously affects the normal growth and development of plants, resulting in crop yield reduction. Cadmium is enriched in crop plants and can also enter humans and animals through the food chain, thereby endangering the health of humans and animals. Rice is one of the most important crops in my country. The rice production area accounts for about 40% of the crop planting area. Compared with other crops, rice has a certain tolerance to cadmium, and it is easy to absorb and enrich ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/54C12N9/10C12N15/84A01H5/00
CPCC12N9/1088C12N15/8205C12N15/8271C12Y205/01018
Inventor 秦瑞英杨剑波杨亚春魏鹏程李浩李娟李莉许蓉芳
Owner RICE RES ISTITUTE ANHUI ACAD OF AGRI SCI