Unlock instant, AI-driven research and patent intelligence for your innovation.

Codon optimized severe fever with thrombocytopenia syndrome virus (SFTSV) glycoprotein Gn gene sequence carrying tPA signal peptide and nucleic acid vaccine thereof

A codon optimization and gene sequence technology, applied in DNA/RNA vaccination, vaccines, genetic engineering, etc., can solve problems such as differences in usage preferences and inefficient expression of foreign genes

Inactive Publication Date: 2016-10-12
李军 +6
View PDF1 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] However, nucleic acid vaccines also have many shortcomings, the most important of which is that the research and application objects of nucleic acid vaccines are mainly eukaryotes, and the vast majority of target genes come from prokaryotes such as viruses or bacteria. There are obvious differences in codon usage preferences, which leads to the inability of the foreign gene of the nucleic acid vaccine to be efficiently expressed in eukaryotic cells, and cannot effectively stimulate the body's immune system to respond

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Codon optimized severe fever with thrombocytopenia syndrome virus (SFTSV) glycoprotein Gn gene sequence carrying tPA signal peptide and nucleic acid vaccine thereof
  • Codon optimized severe fever with thrombocytopenia syndrome virus (SFTSV) glycoprotein Gn gene sequence carrying tPA signal peptide and nucleic acid vaccine thereof
  • Codon optimized severe fever with thrombocytopenia syndrome virus (SFTSV) glycoprotein Gn gene sequence carrying tPA signal peptide and nucleic acid vaccine thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0044] Example 1. Design and synthesis of codon-optimized SFTSV nucleoprotein gene sequence

[0045] OptimumGene TM The gene sequence SEQ ID NO.1 encoding SFTSV glycoprotein Gn was analyzed to find out its codon usage bias and the positions different from mammalian usage bias. For the codon sites with different usage preferences, the codons preferred by mammalian cells were substituted, and the codon-optimized SFTSV glycoprotein Gn gene sequence SEQ ID NO.2 was designed and screened. The protein amino acid sequence encoded by the codon-optimized gene sequence is consistent with its original amino acid sequence. The above-mentioned codon-optimized gene sequence was synthesized by Nanjing GenScript Biotechnology Co., Ltd., loaded into the vector pUC57, and constructed into a recombinant plasmid pUC57-WSP-Gn-opt. The synthesized sequence was confirmed to be correct by sequencing.

[0046] In order to clearly show the site for codon optimization, the nucleic acid sequence WSP-G...

Embodiment 2

[0053] Example 2. Construction of eukaryotic expression vectors pJW4303-WSP-Gn and pJW4303-tPA-Gn-opt

[0054] (1) Obtaining the target fragment and vector

[0055] 1) Obtaining of WSP-Gn fragments and large linear fragments of plasmid pJW4303: using pUC57-WSP-Gn as a template, using primer WSP-Gn-F (CCC AAGCTT ATGATGAAAGTCATCTGG) and WSP-Gn-R (GAGCTC GGATCC CTATTACTCAATCCTAACATCATC) PCR amplified SFTSV glycoprotein Gn gene sequence, and the amplified product was double digested with HindⅢ and BamH Ⅰ. And the vector plasmid pJW4303 was digested with HindⅢ and BamH Ⅰ. Enzyme digestion reaction system: 10×Buffer Tango TM 4 μl, pJW4303 or corresponding PCR product 10 μl, HindⅢ 2 μl, BamH Ⅰ 2 μl, rehydrate to 40 μl, 37°C, 2h.

[0056] 2) Acquisition of tPA-Gn-opt fragments and large linear fragments of plasmid pJW4303: using pUC57-WSP-Gn-opt as a template, using primer tPA-Gn-opt-F (GTCACTTC GCTAGC GACAGTGGACCTATTATCTGCG) and tPA-Gn-opt-R (GAGCTC GGATCC CTATTACTCAATCCGCA...

Embodiment 3

[0059] Example 3. Identification of recombinant plasmids pJW4303-WSP-Gn, pJW4303-tPA-Gn-opt

[0060] 3.1 pJW4303-WSP-Gn, pJW4303-tPA-Gn-opt transform HB101 competent cells respectively

[0061] 1) Under sterile conditions, 5 μl of pJW4303-WSP-Gn and pJW4303-tPA-Gn-opt were respectively added to 100 μl of Escherichia coli HB101 competent cells, mixed gently, and placed in an ice bath for 30 minutes.

[0062] 2) Place the Ep tube containing the cell suspension in a 42°C water bath for 90 seconds.

[0063] 3) After the heat shock treatment, the cells were quickly placed on ice for 2-3 minutes.

[0064] 4) Add 800 μl of LB culture solution without ampicillin, place in a constant temperature shaking incubator, and incubate for 50 minutes at 37° C. and 100 rpm.

[0065] 5) Use a pipette to take 0.2ml pJW4303-WSP-Gn, pJW4303-tPA-Gn-opt transformation bacteria solution and spread it on the agar culture plate containing 100μg / ml ampicillin.

[0066] 6) Put the petri dish face up and...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention belongs to the technical field of biological medicines, and relates to a codon optimized severe fever with thrombocytopenia syndrome virus (SFTSV) glycoprotein Gn gene sequence carrying tPA signal peptide and a nucleic acid vaccine thereof. The SFTSV glycoprotein Gn nucleic acid vaccine is composed of the codon optimized SFTSV glycoprotein Gn gene sequence and a eukaryotic expression vector pJW4303, and the 5'end of the SFTSV glycoprotein Gn gene sequence is connected with a tPA signal peptide sequence. Compared with a nucleic acid vaccine in a wild type state, the nucleic acid vaccine can express objective protein more efficiently and can effectively secrete the objective protein out of cells in gene expression, and an immune system can be effectively stimulated to produce good humoral immune response after a mammal is inoculated with the nucleic acid vaccine.

Description

technical field [0001] The invention belongs to the technical field of biomedicine, and relates to the amino terminal glycoprotein Gn gene sequence of severe fever with thrombocytopenia syndrome virus carrying tPA signal peptide and codon optimization and its nucleic acid vaccine. Background technique [0002] Severe fever with thrombocytopenia syndrome virus (SFTSV) is a new type of virus first discovered and identified by Chinese scholars in 2010. Fever with thrombocytopenia syndrome (SFTS) is a new infectious disease caused by SFTSV infection, characterized by fever, thrombocytopenia, and leukopenia. In severe cases, nervous system damage, hemophagocytosis, and multiple organ functions may occur. Failure, etc., the case fatality rate can reach 12%-16.3%, and it is even reported as 30%. [0003] SFTSV belongs to the genus Phlebovirus in the Bunyaviridae family. Genome sequence analysis shows that its genome is single-stranded negative-strand RNA, which consists of three ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/40A61K39/12A61P31/14
CPCC07K14/005A61K39/12A61K2039/53A61K2039/575C12N2760/12222C12N2760/12234
Inventor 李军金柯刘源徐菱遥韩亚萍刘艳周宜庆
Owner 李军