Codon optimized severe fever with thrombocytopenia syndrome virus (SFTSV) glycoprotein Gn gene sequence carrying tPA signal peptide and nucleic acid vaccine thereof
A codon optimization and gene sequence technology, applied in DNA/RNA vaccination, vaccines, genetic engineering, etc., can solve problems such as differences in usage preferences and inefficient expression of foreign genes
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0044] Example 1. Design and synthesis of codon-optimized SFTSV nucleoprotein gene sequence
[0045] OptimumGene TM The gene sequence SEQ ID NO.1 encoding SFTSV glycoprotein Gn was analyzed to find out its codon usage bias and the positions different from mammalian usage bias. For the codon sites with different usage preferences, the codons preferred by mammalian cells were substituted, and the codon-optimized SFTSV glycoprotein Gn gene sequence SEQ ID NO.2 was designed and screened. The protein amino acid sequence encoded by the codon-optimized gene sequence is consistent with its original amino acid sequence. The above-mentioned codon-optimized gene sequence was synthesized by Nanjing GenScript Biotechnology Co., Ltd., loaded into the vector pUC57, and constructed into a recombinant plasmid pUC57-WSP-Gn-opt. The synthesized sequence was confirmed to be correct by sequencing.
[0046] In order to clearly show the site for codon optimization, the nucleic acid sequence WSP-G...
Embodiment 2
[0053] Example 2. Construction of eukaryotic expression vectors pJW4303-WSP-Gn and pJW4303-tPA-Gn-opt
[0054] (1) Obtaining the target fragment and vector
[0055] 1) Obtaining of WSP-Gn fragments and large linear fragments of plasmid pJW4303: using pUC57-WSP-Gn as a template, using primer WSP-Gn-F (CCC AAGCTT ATGATGAAAGTCATCTGG) and WSP-Gn-R (GAGCTC GGATCC CTATTACTCAATCCTAACATCATC) PCR amplified SFTSV glycoprotein Gn gene sequence, and the amplified product was double digested with HindⅢ and BamH Ⅰ. And the vector plasmid pJW4303 was digested with HindⅢ and BamH Ⅰ. Enzyme digestion reaction system: 10×Buffer Tango TM 4 μl, pJW4303 or corresponding PCR product 10 μl, HindⅢ 2 μl, BamH Ⅰ 2 μl, rehydrate to 40 μl, 37°C, 2h.
[0056] 2) Acquisition of tPA-Gn-opt fragments and large linear fragments of plasmid pJW4303: using pUC57-WSP-Gn-opt as a template, using primer tPA-Gn-opt-F (GTCACTTC GCTAGC GACAGTGGACCTATTATCTGCG) and tPA-Gn-opt-R (GAGCTC GGATCC CTATTACTCAATCCGCA...
Embodiment 3
[0059] Example 3. Identification of recombinant plasmids pJW4303-WSP-Gn, pJW4303-tPA-Gn-opt
[0060] 3.1 pJW4303-WSP-Gn, pJW4303-tPA-Gn-opt transform HB101 competent cells respectively
[0061] 1) Under sterile conditions, 5 μl of pJW4303-WSP-Gn and pJW4303-tPA-Gn-opt were respectively added to 100 μl of Escherichia coli HB101 competent cells, mixed gently, and placed in an ice bath for 30 minutes.
[0062] 2) Place the Ep tube containing the cell suspension in a 42°C water bath for 90 seconds.
[0063] 3) After the heat shock treatment, the cells were quickly placed on ice for 2-3 minutes.
[0064] 4) Add 800 μl of LB culture solution without ampicillin, place in a constant temperature shaking incubator, and incubate for 50 minutes at 37° C. and 100 rpm.
[0065] 5) Use a pipette to take 0.2ml pJW4303-WSP-Gn, pJW4303-tPA-Gn-opt transformation bacteria solution and spread it on the agar culture plate containing 100μg / ml ampicillin.
[0066] 6) Put the petri dish face up and...
PUM
| Property | Measurement | Unit |
|---|---|---|
| molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 