Preparation method of coxsackievirus antigen and rapid detection kit prepared by utilizing antigen and used for detecting coxsackievirus antibody

A coxsackie virus and antigen technology, which is applied in the field of clinical medical detection to achieve the effects of strong specificity, high antigen yield and obvious effect

Inactive Publication Date: 2016-10-26
LANZHOU YAHUA BIOTECH
View PDF0 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there is no convenient method for rapid detection of Coxsackie virus infection

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation method of coxsackievirus antigen and rapid detection kit prepared by utilizing antigen and used for detecting coxsackievirus antibody
  • Preparation method of coxsackievirus antigen and rapid detection kit prepared by utilizing antigen and used for detecting coxsackievirus antibody
  • Preparation method of coxsackievirus antigen and rapid detection kit prepared by utilizing antigen and used for detecting coxsackievirus antibody

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0049] Example 1 Recombinant Expression, Structure Renaturation and Purification of Recombinant Coxsackievirus VP1 Protein Antigen

[0050] Coxsackievirus type A VP1 gene was synthesized with reference to the GenBank sequence GQ279371.1. The rare codons of Escherichia coli were optimized during the synthesis. The expression vector pET30a was connected with HindII / XhoI enzyme cutting sites. The total target gene was 894bp (297aa), transformed into BL21(DE3), the total expressed recombinant protein was 345aa, the molecular weight was 38.7 kDa, and the isoelectric point was 8.32. The recombinant protein is expressed in the form of inclusion body and can be purified by Ni column.

[0051] gene synthesis sequence

[0052] >CA16, VP1 optimized sequence

[0053] GCGGTGATCCTATCGCCGACATGATCGATCAGACCGTGAACAACCAGGTTAATCGCAGTCTGACCGCACTGCAGGTTCTGCCGACCGCAGCCAATACCGAAGCCAGCAGCCATCGTCTGGGTACCGGTGTGGTTCCGGCCTTACAGGCAGCCGAAACCGGCGCCAGCAGCAACGCAAGCGACAAAAACCTGATCGAGACCCGCTGTGTTCTGAATCACCATAG...

Embodiment 2

[0057] Example 2 Preparation of a Coxsackie virus antibody IgG / IgM gold-labeled rapid detection kit

[0058] The recombinant Coxsackie virus VP1 protein obtained above was used as a detection antigen, and a detection line was coated on a nitrocellulose membrane; refer to figure 2 , prepare Coxsackie virus antibody gold label rapid detection reagent, its composition comprises: be provided with on lining board 10 and be provided with sample loading end water-absorbing layer 4, detection layer 8 and water-absorbing layer 9, be provided with detection layer and sample-loading end water-absorbing layer 4 A gold-labeled anti-Coxsackie virus antibody layer 5 is provided between them, and a detection line 7 and a quality control line 6 are coated on the detection layer 8 . Wherein, the water-absorbing layer 4 at the sample loading end and the water-absorbing layer 9 at the water-absorbing end are made of multi-layer filter paper: the detection layer 8 is a nitrocellulose membrane; th...

Embodiment 3

[0062] Example 3 Determination of Coxsackie virus antibody

[0063] Take 10 μL of serum or plasma sample and drop it into the sample well 2 of the test plate 1, then add 100 μL of the sample diluent into the sample well 2, and observe the test result in the observation window 3, and the observation result is valid within 20 minutes. If the sample contains anti-Coxsackie virus antibody, two red lines appear in the detection line and quality control line in the observation window, and the test result is judged as positive; if the serum does not contain anti-Coxsackie virus antibody, then If a red line is seen at the quality control line of the observation window, the test result is judged as negative; if no red line is visible in the observation window, the test result is invalid.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Diameteraaaaaaaaaa
Molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention relates to an artificial genetic engineering-expressed coxsackievirus antigen, a method for preparing the antigen, a method for rapidly detecting a coxsackievirus antibody and a rapid detection kit used for detecting the coxsackievirus antibody. The method for preparing the antigen comprises the following steps: artificially synthesizing optimized coxsackievirus VP1 protein antigen gene sequences, constructing a prokaryotic expression vector and an escherichia coli-expressed coxsackievirus VP1 protein antigen, and renaturing an inclusion body by adopting a dialysis method, a gradient dilution method and a gel chromatography to obtain a recombinant coxsackievirus VP1 protein antigen with a three-dimensional structure and immunocompetence. The method for rapidly detecting the coxsackievirus antibody comprises the step of applying the coxsackievirus VP1 protein antigen. The rapid detection kit used for detecting the coxsackievirus antibody comprises the coxsackievirus VP1 protein antigen which can be directly used for whole blood detection. The kit comprises a rheumatoid factor processing pad which can remove rheumatoid factors in a sample and directly detect IgM in the sample. The coxsackievirus antigen provided by the invention has high specificity. The invention provides the method for preparing the antigen, the method for rapidly detecting the coxsackievirus antibody and the kit for rapidly detecting the coxsackievirus antibody.

Description

technical field [0001] The invention belongs to the field of clinical medical detection, relates to immunochromatographic detection technology, in particular to a Coxsackie virus antigen used for diagnosing Coxsackie virus infection, a method for preparing the antigen, and a rapid detection method of Coxsackie virus by using the antigen Detection kit. Background technique [0002] Coxsackievirus (Cox V) is a serious pathogenic agent of human diseases, and its infection can cause many diseases, ranging from mild respiratory tract infection diseases to more serious myocarditis, pericarditis and some diseases of the nervous system , and can even cause infant death. Infection during pregnancy can cause nonparalytic poliomyelitis lesions and cause intrauterine infection and teratogenicity. Coxsackie virus is a single-stranded positive-sense RNA virus, the virus particles are spherical, icosahedral three-dimensional symmetry, no envelope. The full length of the genome is 7389~7...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K14/085G01N33/569G01N33/558
CPCC07K14/005C12N2770/32021G01N33/558G01N33/56983G01N2333/085G01N2469/20
Inventor李克生杜惠芬曾潮宁范丽赟许菲菲
OwnerLANZHOU YAHUA BIOTECH