Overexpression of uridine diphosphate glucose pyrophosphorylase gene and its recombinant Lactobacillus acidophilus construction method
A technology of phosphorylase gene and Lactobacillus acidophilus, which is applied in the fields of bioengineering and microbial fermentation, can solve the problem that the freeze-drying survival rate of Lactobacillus acidophilus is rarely affected, and achieve the effect of improving enzyme activity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0030] Construction of recombinant expression vector pMG-LBA0625
[0031] 1. Design PCR primers to amplify the overexpressed uridine diphosphate glucose pyrophosphorylase (LBA0625) gene fragment. The sequence of the PCR primers is as follows: LBA0625 upstream amplification primer: TCGACCTGCAGGCATGCAATGCACCATCATCACCATCATATGAAAGTAAGAAAAGCTAT; LBA0625 downstream amplification primer: GTTTTCAGACTTTGCAAGCTTTATTTATTTTTTCGCTTATC.
[0032] 2. Using the genomic DNA of Lactobacillus acidophilus ATCC 4356 (this Lactobacillus acidophilus has been preserved in the China Common Microorganism Culture Collection and Management Center, the registration number of the preservation center is 1.1878) as a template, the following PCR procedure is carried out:
[0033] (1) 94°C for 4 minutes;
[0034] (2) 98°C 10sec;
[0035] (3) 60°C 5sec;
[0036](4) 1min at 72°C;
[0037] (5) 5 minutes at 72°C;
[0038] Among them, steps (2)-(4) are repeated for 30 cycles.
[0039] Reagent Dosage...
Embodiment 2
[0043] Construction of Lactobacillus acidophilus genetically engineered strains PLY127-1 and PLY127-0
[0044] The pMG-LBA0625 overexpression plasmid prepared in Example 1 was extracted and concentrated by the plasmid mini-extraction kit, and then transformed into Lactobacillus acidophilus ATCC 4356 by electric shock. After recovering at 37°C for 2 hours, smear the erythromycin-resistant plate, and then Cultured at 37° C. for 36 hours, and the transformants were screened, and the transformants were verified by PCR, so as to obtain the recombinant Lactobacillus acidophilus PLY127-1 overexpressing the uridine diphosphate glucose pyrophosphorylase gene LBA0625.
[0045] At the same time, the untreated expression vector pMG36e was extracted and concentrated by a plasmid mini-extraction kit, then transformed into Lactobacillus acidophilus ATCC 4356 by electric shock, recovered at 37°C for 2 hours, coated with erythromycin-resistant plates, and then incubated at 37°C After culturing...
Embodiment 3
[0053] Enzyme Activity Determination of Lactobacillus Acidophilus Engineering Bacteria
[0054] The recombinant Lactobacillus acidophilus PLY127-1 prepared in Example 2 was inoculated in MRS broth medium (formulation: based on 1000 ml distilled water, yeast extract (BR) 5 g, beef extract (BR) 10 g, peptone (BR) 10 g, Tween-801 g, manganese sulfate 0.05 g, magnesium sulfate 0.5 g, sodium acetate 5 g, glucose 20 g, triammonium citrate 2 g, potassium dihydrogen phosphate 2 g, sterilized at 121 ° C for 15 minute)), at 37°C for 18 hours of static culture and activation, to prepare seed culture solution, inoculate the seed culture solution with 2% (v / v) inoculum in MRS broth medium and expand culture for 18 hours, centrifuge at 5000rpm for 15min Discard the supernatant, wash the bacteria with normal saline for 3 times, extract the protein by ultrasonic crushing, centrifuge at 10,000×g for 20min, take the supernatant and use the UGPase kit to detect the enzyme activity (such as Fig...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


