Check patentability & draft patents in minutes with Patsnap Eureka AI!

Overexpression of uridine diphosphate glucose pyrophosphorylase gene and its recombinant Lactobacillus acidophilus construction method

A technology of phosphorylase gene and Lactobacillus acidophilus, which is applied in the fields of bioengineering and microbial fermentation, can solve the problem that the freeze-drying survival rate of Lactobacillus acidophilus is rarely affected, and achieve the effect of improving enzyme activity

Active Publication Date: 2019-08-20
NINGBO UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there have been many reports on improving the lyophilization survival rate by optimizing the formula of lyoprotectant, but there are very few reports on the influence of Lactobacillus acidophilus on its lyophilization survival rate from the perspective of heredity and physiology.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Overexpression of uridine diphosphate glucose pyrophosphorylase gene and its recombinant Lactobacillus acidophilus construction method
  • Overexpression of uridine diphosphate glucose pyrophosphorylase gene and its recombinant Lactobacillus acidophilus construction method
  • Overexpression of uridine diphosphate glucose pyrophosphorylase gene and its recombinant Lactobacillus acidophilus construction method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Construction of recombinant expression vector pMG-LBA0625

[0031] 1. Design PCR primers to amplify the overexpressed uridine diphosphate glucose pyrophosphorylase (LBA0625) gene fragment. The sequence of the PCR primers is as follows: LBA0625 upstream amplification primer: TCGACCTGCAGGCATGCAATGCACCATCATCACCATCATATGAAAGTAAGAAAAGCTAT; LBA0625 downstream amplification primer: GTTTTCAGACTTTGCAAGCTTTATTTATTTTTTCGCTTATC.

[0032] 2. Using the genomic DNA of Lactobacillus acidophilus ATCC 4356 (this Lactobacillus acidophilus has been preserved in the China Common Microorganism Culture Collection and Management Center, the registration number of the preservation center is 1.1878) as a template, the following PCR procedure is carried out:

[0033] (1) 94°C for 4 minutes;

[0034] (2) 98°C 10sec;

[0035] (3) 60°C 5sec;

[0036](4) 1min at 72°C;

[0037] (5) 5 minutes at 72°C;

[0038] Among them, steps (2)-(4) are repeated for 30 cycles.

[0039] Reagent Dosage...

Embodiment 2

[0043] Construction of Lactobacillus acidophilus genetically engineered strains PLY127-1 and PLY127-0

[0044] The pMG-LBA0625 overexpression plasmid prepared in Example 1 was extracted and concentrated by the plasmid mini-extraction kit, and then transformed into Lactobacillus acidophilus ATCC 4356 by electric shock. After recovering at 37°C for 2 hours, smear the erythromycin-resistant plate, and then Cultured at 37° C. for 36 hours, and the transformants were screened, and the transformants were verified by PCR, so as to obtain the recombinant Lactobacillus acidophilus PLY127-1 overexpressing the uridine diphosphate glucose pyrophosphorylase gene LBA0625.

[0045] At the same time, the untreated expression vector pMG36e was extracted and concentrated by a plasmid mini-extraction kit, then transformed into Lactobacillus acidophilus ATCC 4356 by electric shock, recovered at 37°C for 2 hours, coated with erythromycin-resistant plates, and then incubated at 37°C After culturing...

Embodiment 3

[0053] Enzyme Activity Determination of Lactobacillus Acidophilus Engineering Bacteria

[0054] The recombinant Lactobacillus acidophilus PLY127-1 prepared in Example 2 was inoculated in MRS broth medium (formulation: based on 1000 ml distilled water, yeast extract (BR) 5 g, beef extract (BR) 10 g, peptone (BR) 10 g, Tween-801 g, manganese sulfate 0.05 g, magnesium sulfate 0.5 g, sodium acetate 5 g, glucose 20 g, triammonium citrate 2 g, potassium dihydrogen phosphate 2 g, sterilized at 121 ° C for 15 minute)), at 37°C for 18 hours of static culture and activation, to prepare seed culture solution, inoculate the seed culture solution with 2% (v / v) inoculum in MRS broth medium and expand culture for 18 hours, centrifuge at 5000rpm for 15min Discard the supernatant, wash the bacteria with normal saline for 3 times, extract the protein by ultrasonic crushing, centrifuge at 10,000×g for 20min, take the supernatant and use the UGPase kit to detect the enzyme activity (such as Fig...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an overexpressed UGPase (UDP-glucose pyrophosphorylase) gene and a method for constructing recombinant lactobacillus acidophilus thereof. The method is characterized by comprising the specific steps as follows: (1) a UGPase gene LBA0625 is amplified with lactobacillus acidophilus genome DNA as a template; an expression vector pMG36e is subjected to single restriction digest with restriction enzyme Hind III, and after dephosphorylation and gel recovery are performed, a recombinant expression vector is constructed by inserting a PCR amplification product into the expression vector pMG36e; (2) an overexpression plasmid subjected to extraction and concentration is imported into lactobacillus acidophilus through electrotransformation, the lactobacillus acidophilus is resuscitated at 37 DEG C for 2 h, applied to an erythrocin resistant plate and cultured at 37 DEG C for 36 h for screening transformants; the transformants are subjected to PCR verification, and the recombinant lactobacillus acidophilus PLY127-1 of the overexpressed UGPase gene is obtained. The freeze-drying survival rate of the lactobacillus acidophilus can be increased substantially.

Description

technical field [0001] The invention belongs to the technical field of bioengineering and microbial fermentation, and in particular relates to a construction method for overexpressing a uridine diphosphate glucose pyrophosphorylase gene and a recombinant acidophilus lactobacillus. Background technique [0002] Lactobacillus acidophilus (Lactobacillus acidophilus, La.) is the third-generation dairy starter, and is often used as starter and probiotic products in the food and pharmaceutical industries. It is widely present in the intestinal tract of humans and some animals, and has the ability to resist acid and cholate, and can successfully colonize the intestinal tract of animals through the gastrointestinal environment to form a dominant population. When it reaches a certain amount, it can play a very good role in health care . It mainly includes the following aspects: enhancing the body's immunity, alleviating lactose intolerance, delaying the aging of the body, and regula...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/54C12N15/75C12N1/21C12R1/23
Inventor 曾小群彭刘杨潘道东孙洁黄芩吴振孙杨赢曹锦轩
Owner NINGBO UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More