Verticillium dahlia secreted protein elicitor VdCP1 and application thereof

[0031] Example 1 Knockout and pathogenicity detection of vdcp1 gene in Verticillium dahliae

[0032] Verticillium dahliae belongs to the genus Verticillium dahliae. Verticillium dahliae can grow at 10~30℃. The optimum temperature for the growth of pathogens is 20~25℃. Most strains do not grow at 33℃, but some strains are more resistant to high temperature. Can grow slowly. The micro sclerotia has strong resistance to bad environment and can withstand high temperature of 80℃ and low temperature of -30℃. The suitable temperature for germination of microsclerotia is 25~30℃. The colony is white, the primary mycelium is colorless, and then becomes olive brown with compartments; the diameter is 2-4μm; the mycelium is often swollen, and can bud from a single or several roots into micro sclerotia; conidia ellipse Shape, single cell, size 4.0-11.0×1.7-4.2μm; split one by one from the end of conidiophore.

[0033] (1) Knockout of vdcp1 gene

[0034] Extract the Verticillium dahliae genome, using the primer pair vdcp1aF (TGCTCCGTTCCAACCTTCTAGT) (as shown in SEQ ID NO: 3)/vdcp1aR (GCCCAAAAATGCTCCTTCAAGTTGGAAGTTGAGGGGTGATT) (as shown in SEQ ID NO: 4), vdcp1bF (as shown in SEQ ID NO: 4), vdcp1bF (as shown in SEQ ID NO: 4), vdcp1bF (as shown in SEQ ID NO: 4) 5)/vdcp1bR (AAGAACGGATCTATGACATGA) (shown in SEQ ID NO: 6) respectively amplify the upstream and downstream fragments of vdcp1 gene by 1000 bp (94℃ 5min; 94℃ 30s, 60℃ 30s, 72℃ 1min, 35 cycles; 72 ℃ 5min), using the primer pair Hyg-F (TTGAAGGAGCATTTTTGGGC) (shown in SEQ ID NO: 7)/Hyg-R (TTATCTTTGCGAACCCAGGG) (shown in SEQ ID NO: 8) to amplify the hygromycin gene cassette (94°C) 5min; 94℃30s, 55℃30s, 72℃2min, 35cycles; 72℃5min), the three PCR products were subjected to fusion PCR (94℃5min; 94℃30s, 60℃2min, 72℃4min, 20cycles; 72℃ 5min), and then use the fusion PCR product as a template, using the primer pair Nest-F (GGGGACAAGTTTGTACAAAAAAAAAGCAGGCTTGCTCCGTTCCAACCTTCTAGT) (shown in SEQ ID NO: 9)/Nest-R (GGGGACCACTTTGTACAAGAAAGCTGGGTAAGAACGGATCTATGACATGA) (shown in SEQ ID NO: 10) The full-length sequence of the fusion fragment (94℃5min; 94℃30s, 60℃2min, 72℃4min, 20cycles; 72℃5min). After the fusion fragment was recombined into the vector pGKO2-Gateway, the recombinant vector was transformed into Verticillium dahliae using the Agrobacterium-mediated method, and the vdcp1 gene in the Verticillium dahlia genome was replaced with the hygromycin gene cassette to achieve the gene The purpose of knockout.

[0035] (2) Pathogenicity detection of knockout strains

[0036] Using cotton seedlings grown for 4 weeks with 2 true leaves as materials, knockout bodies and wild-type Verticillium dahlia spore suspensions (10 6 /ml) Irrigate the roots of the seedlings, place the treated seedlings at 25°C and continue culturing for 20 days, then count and calculate the disease index.

[0037] Disease index (%)=[Σ(number of diseased leaves at each level×relative value)/(total number of leaves in investigation×4)]×100

[0038] Disease reduction (%)=[(control disease index-treatment disease index)/control disease index]×100

[0039] Verticillium dahliae Disease index (%) Disease reduction (%) Wild type 36.52±1.45A Knockout strain 28.63±1.89B 21.60

[0040] Different letters in the table indicate the significance of the difference at the level of ρ<0.01.

[0041] The above results indicate that the pathogenicity of the knockout strains is significantly reduced, indicating that the VdCP1 protein plays an important role in the process of Verticillium dahliae infecting cotton.

[0042] Example 2 Cloning of the gene encoding protein elicitor VdCP1

[0043] According to the VdCP1 gene sequence, the primers are finally selected after screening and verification:

[0044] VdCP1-forward 5'-ATGCAGCTGTCCAACCTCCT-3 (shown in SEQ ID NO: 11) and VdCP1-reverse 5'-TCAGAGGCCGCACTTGCTCT-3 (shown in SEQ ID NO: 12), extract the Verticillium dahlia strain mRNA, and reverse transcribed into cDNA, using cDNA as template, select HiFi polymerase for PCR amplification (94℃5min; 94℃30s, 55℃30s, 72℃30s, 35cycles; 72℃5min) to amplify 417bp The DNA fragment, which includes a complete open reading frame of 417bp, was named vdcp1 gene. The sequence of this gene is shown in SEQ ID NO:1.

[0045] Example 3 Eukaryotic expression and purification of VdCP1 protein

[0046] (1) Construction of expression vector

[0047] Design a specific primer for the protein elicitor gene vdcp1, and introduce a restriction site with a protection base for restriction. Forward primer: 5’- GAATTC GCCTCTGTCTCCTACGACAA-3', (underlined is the digestion sequence of EcoRI) (shown in SEQ ID NO: 13), reverse primer: 5'- TCTAGA CCGAGGCCGCACTTGCTCTTGT-3', (underlined sequence of XbaI) (as shown in SEQ ID NO: 14), amplify the full-length vdcp1 gene (94°C 5min; 94°C 30s, 55°C 30s, 72°C 30s, 35 cycles; 72°C for 5min). First, clone the vdcp1 gene target fragment into the pMD18-T simple vector. After sequencing verification, the vdcp1 fragment was cloned into the EcoRI/XbaI site of the pPICZαA vector (Invitrogen) after digestion with EcoRI and XbaI.

[0048] (2) Induced expression

[0049] The recombinant vector pPICZαA-vdcp1 obtained in step (1) is heat shocked into the E. coli TransT1 strain, a large number of cultures are performed, and the plasmid is extracted to obtain a high-concentration recombinant vector. The pPICZαA-vdcp1 was linearized with the endonuclease PmeI, and transformed into Pichia pastoris (Pichia pastoris KM71H) by electroporation. The bleomycin antibiotic pressure screening was performed, and the positive clones were selected for inducing expression. Inoculate positive clones into 10ml YPD (1% Yeast Extract, 2% Peptone, 2% Dextrose (glucose)) medium, cultivate overnight at 30°C, 250 rpm, and 10ml seed culture medium Inoculate in 1L BMG (100mM, pH6.0 (or pH7.0) phosphate buffer, 1.34% YNB, 1% glycerol) medium, culture at 30°C, 250rpm for 24h to OD600=6, centrifuge the fermentation broth, and collect the bacteria , Replace with 100ml BHH (100mM, pH6.0 (or pH7.0) phosphate buffer, 1.34% YNB, 0.5% methanol) medium to resuspend the bacteria, 30 ℃, 250 rpm to continue the culture, add the final concentration of 0.5 every 24h % Methanol. After 3 days, collect the supernatant by centrifugation at 12000rpm, take 20μl of the supernatant, add 4μl of 6×SDS loading buffer (denaturation), heat in a boiling water bath for 10 minutes, then perform SDS-PAGE detection, stain with Coomassie Brilliant Blue R250, observe the expression .

[0050] Results: After SDS-PAGE detection, a fusion expressed protein (RVdCP1) with a molecular weight of about 18kD was obtained, which was consistent with the predicted molecular weight.

[0051] (3) Purification of recombinant protein

[0052] use The explorer10 protein purification instrument purifies recombinant proteins. Use HisTrap HP pre-packed column for affinity chromatography, first equilibrate the affinity column with washing buffer; take 5 mL of the recombinant protein solution after centrifugation in step (2) for injection at a flow rate of 1 mL/min. After elution to baseline, The elution buffer is used for elution; the elution peak is collected, and the elution peak components are desalted using an ultrafiltration tube, and then SDS-PAGE electrophoresis is performed to detect the protein purity.

[0053] Result: A purified fusion protein (RVdCP1) of about 18kD was obtained.