High-specific-activity endo-xylanase NPWXynB, and gene and application thereof
An endo-xylanase, high-ratio technology, applied in the field of genetic engineering, can solve the problems of increasing the volume and viscosity of chyme, hindering the digestion and absorption of nutrients, reducing the utilization rate of feed, etc., achieving great application potential and reducing fermentation. The effect of production costs
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0040] Example 1. Synthesis and cloning of rumen fungus Neocallimastix patriciarum endoxylanase XynB gene
[0041] The published rumen fungus Neocallimastix patriciarum endoxylanase XynB gene (Genebank: AF123252) was synthesized.
[0042] Design PCR primers containing EcoRI and NotI restriction enzyme sites at the 5' end and 3' end of the synthesized gene respectively, and the primer sequences are as follows:
[0043] 5' Primer NPWXynB-F1: GTAGAATTCCAAAGTTTCTGTAGTTCAGCTT
[0044]The 3' end primer NPWXynB-R1: ACTGCGGCCGCAGCTGAACTACAGAAACTTTG uses the synthetic gene as a template, and uses the above primers for PCR amplification, and clones the amplified fragment into the vector pGAPzαA to obtain the recombinant vector pGAPzαA-XynB.
Embodiment 2
[0045] Embodiment 2, gene error-prone PCR random mutation
[0046] Using the above pGAPzαA-XynB as a template, carry out error-prone PCR random mutation amplification. The specific amplification method is:
[0047] The first round of amplification: use the vector promoter primers NPWXynB-F1 and NPWXynB-R1 as primers for PCR amplification, and the reaction system is as follows:
[0048]
[0049] The reaction procedure is as follows:
[0050]
[0051] The first-round PCR product was recovered, and 1uL was diluted 50-100 times to be used as a template for the second-round PCR. In the second round of error-prone PCR, PCR reactions were also performed with specific primers NPWXynB-F1 and NPWXynB-R1.
[0052] The product of the second round was double digested with EcoRI and NotI, and connected to the pGAPzαA vector. The ligation product was transformed into Pichia pastoris X33, and the mutant strains were screened on YPDZ agarose plate.
Embodiment 3
[0053] Embodiment 3, high-throughput screening high specific activity mutant strain
[0054] Pick mutant single colonies from the error-prone PCR plate in Example 2, pick the recombinant transformants one by one to a 24-well plate with a toothpick, add 1mL medium containing YPD to each well, culture at 30°C, 220rpm for about 48 hours, and take it by centrifugation. clear. 200 μL of the above supernatants were taken out to a 96-well plate for xylanase activity assay. The detection of xylanase activity was carried out with reference to the national standard "GB / T 23874-2009" of the People's Republic of China. Genomic DNA was extracted from 7 positive mutant clones with improved enzyme activity, and the target gene was amplified by PCR to determine the mutation site.
[0055] The sequencing results determined the amino acid mutation site, the mutation site of clone 1 was +78M replaced by +78Y; the mutation site of clone 2 was +94Y replaced by +94S; the mutation site of clone 3 ...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com