High-specific-activity endo-xylanase NPWXynB, and gene and application thereof

An endo-xylanase, high-ratio technology, applied in the field of genetic engineering, can solve the problems of increasing the volume and viscosity of chyme, hindering the digestion and absorption of nutrients, reducing the utilization rate of feed, etc., achieving great application potential and reducing fermentation. The effect of production costs

Active Publication Date: 2017-06-13
GUANGDONG VTR BIO TECH
View PDF2 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

As a non-starch polysaccharide, xylan has a strong anti-nutritional effect. The main manifestations are: monogastric animals are difficult to digest and absorb xylan; xylan can bind a large amount of water, increasing the volume and viscosity of chyme in the animal's digestive tract Thus hindering the digestion and absorption of nutrients and reducing the utilization rate of feed

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • High-specific-activity endo-xylanase NPWXynB, and gene and application thereof
  • High-specific-activity endo-xylanase NPWXynB, and gene and application thereof
  • High-specific-activity endo-xylanase NPWXynB, and gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] Example 1. Synthesis and cloning of rumen fungus Neocallimastix patriciarum endoxylanase XynB gene

[0041] The published rumen fungus Neocallimastix patriciarum endoxylanase XynB gene (Genebank: AF123252) was synthesized.

[0042] Design PCR primers containing EcoRI and NotI restriction enzyme sites at the 5' end and 3' end of the synthesized gene respectively, and the primer sequences are as follows:

[0043] 5' Primer NPWXynB-F1: GTAGAATTCCAAAGTTTCTGTAGTTCAGCTT

[0044]The 3' end primer NPWXynB-R1: ACTGCGGCCGCAGCTGAACTACAGAAACTTTG uses the synthetic gene as a template, and uses the above primers for PCR amplification, and clones the amplified fragment into the vector pGAPzαA to obtain the recombinant vector pGAPzαA-XynB.

Embodiment 2

[0045] Embodiment 2, gene error-prone PCR random mutation

[0046] Using the above pGAPzαA-XynB as a template, carry out error-prone PCR random mutation amplification. The specific amplification method is:

[0047] The first round of amplification: use the vector promoter primers NPWXynB-F1 and NPWXynB-R1 as primers for PCR amplification, and the reaction system is as follows:

[0048]

[0049] The reaction procedure is as follows:

[0050]

[0051] The first-round PCR product was recovered, and 1uL was diluted 50-100 times to be used as a template for the second-round PCR. In the second round of error-prone PCR, PCR reactions were also performed with specific primers NPWXynB-F1 and NPWXynB-R1.

[0052] The product of the second round was double digested with EcoRI and NotI, and connected to the pGAPzαA vector. The ligation product was transformed into Pichia pastoris X33, and the mutant strains were screened on YPDZ agarose plate.

Embodiment 3

[0053] Embodiment 3, high-throughput screening high specific activity mutant strain

[0054] Pick mutant single colonies from the error-prone PCR plate in Example 2, pick the recombinant transformants one by one to a 24-well plate with a toothpick, add 1mL medium containing YPD to each well, culture at 30°C, 220rpm for about 48 hours, and take it by centrifugation. clear. 200 μL of the above supernatants were taken out to a 96-well plate for xylanase activity assay. The detection of xylanase activity was carried out with reference to the national standard "GB / T 23874-2009" of the People's Republic of China. Genomic DNA was extracted from 7 positive mutant clones with improved enzyme activity, and the target gene was amplified by PCR to determine the mutation site.

[0055] The sequencing results determined the amino acid mutation site, the mutation site of clone 1 was +78M replaced by +78Y; the mutation site of clone 2 was +94Y replaced by +94S; the mutation site of clone 3 ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the field of gene engineering, particularly a high-specific-activity endo-xylanase NPWXynB, and a gene and application thereof. Orthogenesis and site-directed mutagenesis are utilized to perform molecular modification on endo-xylanase XynB derived from rumen fungus Neocallimastix patriciarum to obtain the high-specific-activity xylanase NPWXynB. In the amino acid sequence, the 58th site Y is substituted by F, the 78th site M is substituted by Y, the 94th site Y is substituted by S, the 143rd site V is substituted by L, the 145th site E is substituted by R, and the 182nd site D is substituted by R. The specific activity of the endo-xylanase mutant NPWXynB provided by the invention is 11500 U / mg under the condition of 37 DEG C, which is enhanced by 82.5% as compared with the specific activity of the original endo-xylanase XynB. The maximum enzyme activity of the NPWXynB-gene-containing recombinant engineering bacterium can reach 153000 U / mL, and the production cost is greatly lowered.

Description

technical field [0001] The invention relates to the field of genetic engineering, in particular, the invention relates to a high specific activity mutant endoxylanase NPWXynB and its gene and application. Background technique [0002] As a five-carbon sugar, xylan is an important component of hemicellulose and widely exists in nature. Xylan accounts for almost one-third of the planet's renewable organic carbon content and is the second most abundant polysaccharide after cellulose. Xylan accounts for 7%-12% of dry matter weight in gymnosperms and 15%-30% of dry matter weight in angiosperms. At the same time, xylan is also widely present in feed materials such as wheat and corn. As a non-starch polysaccharide, xylan has a strong anti-nutritional effect, mainly as follows: monogastric animals are difficult to digest and absorb xylan; xylan can bind a large amount of water, increasing the volume and viscosity of chyme in the animal's digestive tract Thereby hindering the diges...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/42C12N15/56C12N15/81C12N1/19C12R1/84
CPCC12N9/2482C12Y302/01008
Inventor李阳源王建荣周银华夏雨杨玲
OwnerGUANGDONG VTR BIO TECH