Unlock instant, AI-driven research and patent intelligence for your innovation.

Recombinant carbonyl reductase mutant, gene, vector, engineering bacteria and application thereof

A technology of genetic engineering bacteria and recombinant vector, which is applied in the application field of preparing tert-butyl-6-chloro-3,5-dihydroxyhexanoate, and can solve the problem that the optical purity of the product is difficult to meet the requirements and the diastereomeric induction is insufficient. , low yield and other problems, to achieve the effect of improving catalytic activity and substrate tolerance, shortening the time-consuming reaction process, and reducing the reaction cost

Active Publication Date: 2020-10-09
ZHEJIANG UNIV OF TECH
View PDF8 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Synthesis of (3R,5S)-6-chloro-3,5-dihydroxyhexanoic acid tert-butyl ester often starts from a simple compound, such as (S)-epichlorohydrin, and synthesizes what we have through a series of chemical reactions The required intermediate material, wherein the introduction of the C3 chiral center needs to use flammable and explosive sodium borohydride as a reducing agent, and it needs to be carried out at a low temperature of <-65°C, which consumes a lot of energy. In addition, (3R, 5S)-6-Chloro-3,5-dihydroxyhexanoic acid tert-butyl ester is insufficiently induced, the optical purity of the product is difficult to meet the requirements, and the final yield is not high

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant carbonyl reductase mutant, gene, vector, engineering bacteria and application thereof
  • Recombinant carbonyl reductase mutant, gene, vector, engineering bacteria and application thereof
  • Recombinant carbonyl reductase mutant, gene, vector, engineering bacteria and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] Example 1: Construction of recombinant carbonyl reductase genetically engineered bacteria BL21(DE3) / pET28a-RtSCR9

[0039] From Rhodosporidium toruloides (Rhodosporidium toruloides) ZJB2014212 (CCTCC NO.M2014613, disclosed in the patent application CN 105039361 A) has catalytic (S)-6-chloro-5-hydroxyl-3-oxohexanoic acid tertiary The enzyme capable of generating (3R,5S)-6-chloro-3,5-dihydroxyhexanoic acid tert-butyl ester from butyl ester is the carbonyl reductase RtSCR9 involved in the present invention.

[0040] The total mRNA of Rhodosporidium toruloides) ZJB2014212 cells was extracted by TRIzol reagent of Ambion Company. Using 1 mg of mRNA as a template, it was reverse-transcribed to synthesize cDNA using the ReverTra AceqPCR RT Kit. Using the cDNA as a template, PCR amplification was performed under the action of primer 1 (ATGTCTTCGCCTACTCCCAACGTC) and primer 2 (CTACCATGGCAAGAACGTCCCGTC). PCR reaction conditions: pre-denaturation at 95°C for 5min, 95°C for 30s, 65...

Embodiment 2

[0041] Embodiment 2: Obtaining of recombinant carbonyl reductase mutant

[0042] Using the recombinant bacteria (E.coli BL21(DE3) / pET28a-RtSCR9) containing the expression vector pET28a-RtSCR9 as the starting strain, through random mutation and site-directed saturation mutation techniques, the ability of carbonyl reductase to substrate (S)-6- Catalytic activity and substrate tolerance of tert-butyl chloro-5-hydroxy-3-oxohexanoate.

[0043] (1) Error-prone PCR and PCR with large primers

[0044] Error-prone PCR upstream primer 5: 5'-TATGTCTTCGCCTACTCCCAAC-3'

[0045] Error-prone PCR downstream primer 6: 5'-TCTACCATGGCAAGAACGTCC-3'

[0046] Error-prone PCR by changing the Mn in the PCR system 2+ , Mg 2+ The wrong bases are randomly incorporated into the amplified gene at a certain frequency, so as to obtain a randomly mutated DNA population. In the present invention, the plasmid DNA where the RtSCR9 gene (the nucleotide sequence is shown in SEQ ID NO.1 and the amino acid seque...

Embodiment 3

[0062] Example 3: Preparation of recombinant carbonyl reductase mutant wet thallus

[0063] Inoculate the recombinant Escherichia coli containing the recombinant carbonyl reductase mutant gene obtained in Example 2 into LB liquid medium containing kanamycin resistance at a final concentration of 50 μg / mL, culture at 37°C for 8 hours at 150 rpm, and then inoculate with 1 % inoculum size (v / v) was inoculated into fresh LB liquid medium containing a final concentration of 50 μg / mL kanamycin resistance, and cultured at 37°C and 150 rpm until the cell OD 600 After reaching 0.6-0.8, add IPTG with a final concentration of 0.1mM, induce culture at 28°C for 12h, centrifuge at 8000×g for 10min at 4°C, discard the supernatant, collect the precipitate, and obtain mutants containing recombinant carbonyl reductase Genetic recombinant E. coli wet cells. The wet thalline can be used directly as a biocatalyst or for protein purification. The wet cells of recombinant Escherichia coli (BL21(DE...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a recombinant carbonyl reductase mutant, a gene, a vector, an engineering bacterium and application of the recombinant carbonyl reductase mutant. The mutant is obtained by performing single-point mutation on the 95th locus, the 144th locus or the 156th locus of an amino acid sequence shown as SEQ ID NO.2. The recombinant carbonyl reductase mutant has reduced (S)-6-chloro-5-hydroxy-3-oxohexanoate, and compared with a wild type enzyme, has the advantages that the catalytic activity and the substrate tolerance are greatly improved when such reaction is converted, and the time consumption of a reaction process is obviously reduced. Compared with a chemical method for preparing (3R,5S)-6-chloro-3,5-dihydroxyhexanoate, such a technology has the advantages that an obtained product is high in stereoselectivity, a tedious chemical catalysis step is simplified, the reaction condition is milder, the requirement on equipment is low, the reaction cost is reduced, and the technology is environment-friendly.

Description

[0001] (1) Technical field [0002] The invention belongs to the field of biopharmaceuticals and biotransformation, and specifically relates to a carbonyl reductase mutant, a mutant gene, a recombinant vector containing the mutant gene, a recombinant genetically engineered bacterium obtained by transforming the recombinant vector, and its preparation (3R, 5S) - Application of tert-butyl 6-chloro-3,5-dihydroxyhexanoate. [0003] (2) Background technology [0004] Stereoselective carbonyl reductase (Specific Carbonyl Reducatase, SCR; Ketoreductase, KRED, E.C 1.1.1.x) belongs to the oxidoreductase system, which is a class of enzymes that can catalyze the bidirectional reversible redox reaction between alcohols and aldehydes / ketones. And the coenzyme NAD(H) (nicotinamide adenine dinucleotide) or NADP(H) (nicotinamide adenine dinucleotide phosphate) is required as a hydrogen transporter. NADH and NADPH participate in its reduction reaction as electron donors, NAD + and NADP + It ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N9/04C12N15/53C12N15/70C12N1/21C12P7/62
CPCC12N9/0006C12N15/70C12P7/62C12Y101/01
Inventor 柳志强郑裕国吴林张晓建薛亚平王亚军
Owner ZHEJIANG UNIV OF TECH