Recombinant carbonyl reductase mutant, gene, vector, engineering bacteria and application thereof
A technology of genetic engineering bacteria and recombinant vector, which is applied in the application field of preparing tert-butyl-6-chloro-3,5-dihydroxyhexanoate, and can solve the problem that the optical purity of the product is difficult to meet the requirements and the diastereomeric induction is insufficient. , low yield and other problems, to achieve the effect of improving catalytic activity and substrate tolerance, shortening the time-consuming reaction process, and reducing the reaction cost
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0038] Example 1: Construction of recombinant carbonyl reductase genetically engineered bacteria BL21(DE3) / pET28a-RtSCR9
[0039] From Rhodosporidium toruloides (Rhodosporidium toruloides) ZJB2014212 (CCTCC NO.M2014613, disclosed in the patent application CN 105039361 A) has catalytic (S)-6-chloro-5-hydroxyl-3-oxohexanoic acid tertiary The enzyme capable of generating (3R,5S)-6-chloro-3,5-dihydroxyhexanoic acid tert-butyl ester from butyl ester is the carbonyl reductase RtSCR9 involved in the present invention.
[0040] The total mRNA of Rhodosporidium toruloides) ZJB2014212 cells was extracted by TRIzol reagent of Ambion Company. Using 1 mg of mRNA as a template, it was reverse-transcribed to synthesize cDNA using the ReverTra AceqPCR RT Kit. Using the cDNA as a template, PCR amplification was performed under the action of primer 1 (ATGTCTTCGCCTACTCCCAACGTC) and primer 2 (CTACCATGGCAAGAACGTCCCGTC). PCR reaction conditions: pre-denaturation at 95°C for 5min, 95°C for 30s, 65...
Embodiment 2
[0041] Embodiment 2: Obtaining of recombinant carbonyl reductase mutant
[0042] Using the recombinant bacteria (E.coli BL21(DE3) / pET28a-RtSCR9) containing the expression vector pET28a-RtSCR9 as the starting strain, through random mutation and site-directed saturation mutation techniques, the ability of carbonyl reductase to substrate (S)-6- Catalytic activity and substrate tolerance of tert-butyl chloro-5-hydroxy-3-oxohexanoate.
[0043] (1) Error-prone PCR and PCR with large primers
[0044] Error-prone PCR upstream primer 5: 5'-TATGTCTTCGCCTACTCCCAAC-3'
[0045] Error-prone PCR downstream primer 6: 5'-TCTACCATGGCAAGAACGTCC-3'
[0046] Error-prone PCR by changing the Mn in the PCR system 2+ , Mg 2+ The wrong bases are randomly incorporated into the amplified gene at a certain frequency, so as to obtain a randomly mutated DNA population. In the present invention, the plasmid DNA where the RtSCR9 gene (the nucleotide sequence is shown in SEQ ID NO.1 and the amino acid seque...
Embodiment 3
[0062] Example 3: Preparation of recombinant carbonyl reductase mutant wet thallus
[0063] Inoculate the recombinant Escherichia coli containing the recombinant carbonyl reductase mutant gene obtained in Example 2 into LB liquid medium containing kanamycin resistance at a final concentration of 50 μg / mL, culture at 37°C for 8 hours at 150 rpm, and then inoculate with 1 % inoculum size (v / v) was inoculated into fresh LB liquid medium containing a final concentration of 50 μg / mL kanamycin resistance, and cultured at 37°C and 150 rpm until the cell OD 600 After reaching 0.6-0.8, add IPTG with a final concentration of 0.1mM, induce culture at 28°C for 12h, centrifuge at 8000×g for 10min at 4°C, discard the supernatant, collect the precipitate, and obtain mutants containing recombinant carbonyl reductase Genetic recombinant E. coli wet cells. The wet thalline can be used directly as a biocatalyst or for protein purification. The wet cells of recombinant Escherichia coli (BL21(DE...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


