SOD (Superoxide Dismutase) gene and encoding protein thereof
A technology of superoxide and dismutase, applied in the directions of oxidoreductase, plant genetic improvement, genetic engineering, etc., can solve problems such as limiting the application of SOD, and achieve the effect of good heat resistance and freeze-thaw resistance
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0018] Construct the protein expression vector of SOD gene by molecular cloning technology
[0019] 1. Perform PCR amplification on the extracted metagenomic DNA (50 μl system)
[0020] The PCR system is as follows:
[0021]
[0022] Sodinfupet15F: GTTAGCAGCCGGATCCTATTTTTATCTGGTTATACCGTCTCTCAACCTCC
[0023] Sodinfupet15R: ATATGCTCGAGGATCccATGAAGTTTAGAAGTATAATCCTTGCAGGGC
[0024] The PCR program was set as follows: pre-denaturation at 94°C for 10 min; (denaturation at 94°C for 30 s, annealing at 50°C for 30 s, extension at 72°C for 45 s), and set 30 cycles; finally, extension at 72°C for 5 min.
[0025] The PCR products were identified by agarose gel electrophoresis, and the results were as follows: figure 1 as shown, figure 1 The first lane from the left is the marker, the second lane is the PCR product, the position of the target band is as follows figure 1 shown.
[0026] The PCR product obtained in this example is sequenced using the sanger method (ABI 3730xl seque...
Embodiment 2
[0049] Protein
[0050] 1. Induced expression
[0051] 1) Take 300 μL of the bacterial solution cultured overnight in Step 7 of Example 1, add it to 30 mL LB, add ampicillin, and culture at 37° C., 200 rpm.
[0052] 2) Measure the OD value after about 2 hours. When the OD value reaches 0.5 (0.3-0.5), add IPTG with a final concentration of 0.1 mM, and then culture at 20° C. and 200 rpm for 12 hours.
[0053] 2. Enzymatically lyse cells (30mL bacterial solution)
[0054] 1) Collect the cells by centrifugation at 4000g for 10 minutes, remove the supernatant, and wash once with high-purity water (resuspend the precipitate in high-purity water and then centrifuge to remove the supernatant).
[0055] 2) Resuspend the pellet corresponding to each 30mL bacterial solution in 1.2mL cell lysis buffer (pH 8.5), and the buffer needs to be added with PMSF.
[0056]3) Add lysozyme powder to a final concentration of 1 mg / mL, mix well, and ice-bath for 30 minutes.
[0057] 4) Transfer the ...
Embodiment 3
[0070] Comparative Test
[0071] GenBank numbering is the gene of SOD enzyme of SDL36756.1, artificially synthesized (synthesized by General Biological Company) whole gene DNA, according to the method for embodiment 1 and embodiment 2, this gene is cloned into expression vector, and induces target protein expression .
[0072] 1. Thermal stability test
[0073] After the lysed supernatant of the genetically engineered bacteria expressing the target protein was incubated at 80°C for 10 minutes, the SOD enzyme activity was measured. Compared with the control group without high temperature treatment, it was found that it retained 60% of the activity.
[0074] 2. Freeze-thaw resistance
[0075] Put the lysed supernatant of the genetically engineered bacteria expressing the target protein into a ‐86°C ultra-low temperature refrigerator, freeze for 12 hours, take it out, and thaw it at room temperature (25°C), and measure the SOD enzyme activity again. In comparison, it was found...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More