A kind of method utilizing escherichia coli fermentation to produce thymidine phosphorylase

A technology of thymidine phosphorylase and Escherichia coli, which is applied in the field of bioengineering, can solve problems such as difficult removal of optical isomers, danger of environmental pollution, and complicated separation and extraction, so as to improve total enzyme activity, reduce production costs, and facilitate Promoted app performance

Active Publication Date: 2021-02-02
NANJING NUOYUN BIOLOGICAL TECH CO LTD
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there are mainly two methods for the preparation of thymidine: chemical synthesis and DNA enzymatic hydrolysis: the crude thymidine obtained by the chemical synthesis method contains oil, pigment, 5-methyluridine and other thymidine derivatives, and there are optical differences The structure is difficult to remove; the process also requires the use of a large amount of toxic and harmful organic solvents, which is also dangerous to environmental pollution
The enzymatic hydrolysis method hydrolyzes natural substances such as RNA or DNA, and the obtained crude thymidine contains deoxyadenosine (dA), deoxycytidine (dC), deoxyguanosine (dG), deoxyinosine (dI) and other impurities, Separation and extraction is very complicated

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of method utilizing escherichia coli fermentation to produce thymidine phosphorylase
  • A kind of method utilizing escherichia coli fermentation to produce thymidine phosphorylase
  • A kind of method utilizing escherichia coli fermentation to produce thymidine phosphorylase

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0020] Escherichia coli MG1655 was cultured in LB medium at a controlled temperature of 37.0 °C and 180 rpm for 1 day, the precipitate was collected by centrifugation, and the genomic DNA of Escherichia coli MG1655 was extracted and purified with the DNA extraction and purification kit QiAamp Kit (Qiagen, Germany).

[0021] PCR amplification of Escherichia coli MG1655 genomic DNA was carried out with Pfu high-fidelity enzyme, and the primers used were

[0022] 1655TP-F 5'ATGTTTCTCGCACAAGAAATTATTCG 3'

[0023] 1655TP-R 5’TTATTCGCTGATACGGCGATAGA 3’

[0024] Since the GC content of the DNA of Escherichia coli MG1655 is close to 50%, it was directly amplified using Pfu high-fidelity enzyme. Afterwards, the amplified fragment was treated with Taq polymerase at 72°C for 10 minutes, and base A was added to the 3' end of the DNA. Afterwards, it was connected to the pMD19T-simple (Takara Bao Biological Company, Beijing) cloning vector, and a single clone was picked and sent to Nanjin...

Embodiment 2

[0026] Through the method of whole gene synthesis, the secondary structure and codon bias of the gene are adjusted to achieve high expression in Escherichia coli. At the same time, five amino acid mutations at the following positions were introduced during synthesis: L10A, A209G, F210G, A221V, A413D, using Primer Premier (http: / / primer3.ut.ee / ) and OPTIMIZER (http: / / genomes.urv. es / OPTIMIZER / ) to design, and ensure that the Tm difference is controlled within 3°C, and the primer length is controlled within 50 base, the following primers are obtained:

[0027]

[0028]

[0029] The above primers were synthesized, and the obtained primers were dissolved in double-distilled water, and then added to the following reaction system, so that the final concentration of each primer was 30 nM, and the final concentration of the first and last primers was 0.6 μM.

[0030] 2mM dNTP mix (2mM each dNTP) 5μl 10×Pfu buffer 5μl Pfu DNA polymerase (10U / μl) 0.5μl ...

Embodiment 3

[0033] Pick a single colony of Escherichia coli containing the expression vector of SEQ ID NO.3 and inoculate it in 10ml of high-pressure sterilized medium: tryptone 10g / L, yeast extract 5g / L, disodium hydrogen phosphate 3.55g / L, phosphoric acid Potassium dihydrogen 3.4g / L, Ammonium chloride 2.68g / L, Sodium sulfate 0.71g / L, Magnesium sulfate heptahydrate 0.493g / L, Ferric chloride hexahydrate 0.027g / L, Glycerin 5g / L, Glucose 0.8g / L, add kanamycin to 50mg / L. Cultivate overnight at 30°C, 250rpm. The next day, take a 1L Erlenmeyer flask and insert it into 100ml of autoclaved medium at an inoculation ratio of 1:100: tryptone 10g / L, yeast extract 5g / L, disodium hydrogen phosphate 3.55g / L, phosphoric acid Potassium dihydrogen 3.4g / L, Ammonium chloride 2.68g / L, Sodium sulfate 0.71g / L, Magnesium sulfate heptahydrate 0.493g / L, Ferric chloride hexahydrate 0.027g / L, Glycerin 5g / L, Glucose 0.3g / L, add kanamycin to 50mg / L. Cultivate at 30°C until the cell OD is 5-6, immediately place t...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a method for producing thymidine phosphorylase by Escherichia coli fermentation, belonging to the field of bioengineering. The present invention can effectively improve the total enzyme activity per unit bacterium by expressing the thymidine phosphorylase mutant, and can effectively reduce the production cost of the anti-AIDS drug intermediate β-thymidine. As long as the general fermentation workshop (such as amino acid and vitamin production workshop) can be put into production, no special equipment is needed, and it is easy to popularize and apply.

Description

technical field [0001] The invention relates to a method for producing thymidine phosphorylase by Escherichia coli fermentation, belonging to the field of bioengineering. Background technique [0002] Thymidine is an important pharmaceutical raw material intermediate and biochemical reagent, which is widely used in the research and production of biochemical industry. Thymidine is an important raw material for the preparation of anti-AIDS drug - azidothymidine (AZT), but its content must be more than 98%, and the content of 5-methyluridine cannot exceed 0.3%. At present, there are mainly two methods for the preparation of thymidine: chemical synthesis and DNA enzymatic hydrolysis: the crude thymidine obtained by the chemical synthesis method contains oil, pigment, 5-methyluridine and other thymidine derivatives, and there are optical differences The structure is difficult to remove; the process also requires the use of a large amount of toxic and harmful organic solvents, wh...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N9/10C12R1/19
CPCC12N9/1077C12Y204/02004
Inventor丁雪峰
OwnerNANJING NUOYUN BIOLOGICAL TECH CO LTD