Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Detection kit and detecting method for new potyviridae virus in nelumbo nucifera

A technology for detection kits and detection methods, applied in the direction of microorganism-based methods, biochemical equipment and methods, and microbial measurement/inspection, can solve the problems of lack of genome sequence, unclear host range, and inability to use detection, etc., to achieve Effects of saving time, overcoming cumbersome steps, and improving operability

Active Publication Date: 2017-11-24
YANGZHOU UNIV
View PDF2 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Due to the lack of a complete genome sequence of the virus, antiserum cannot be prepared, and it cannot be detected by enzyme-linked immunosorbent assay (ELISA); the host range is not clear, and the identification host cannot be determined yet

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Detection kit and detecting method for new potyviridae virus in nelumbo nucifera
  • Detection kit and detecting method for new potyviridae virus in nelumbo nucifera
  • Detection kit and detecting method for new potyviridae virus in nelumbo nucifera

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0024] (1) Primer design and synthesis

[0025] According to the results of high-throughput sequencing analysis of lotus root small RNA, a specific primer for the new Potatoviridae virus was designed and synthesized: SPLVF2-1 (GAATCGTATCAATCCTTGAG)

[0026] and SPLVR3-1 (GCTTCTGCGACATCACTAAAG);

[0027] (2) Extraction of total RNA

[0028] Polysaccharide and polyphenol plant tissue lysis method

[0029] (3) RT-PCR

[0030] ① cDNA synthesis by reverse transcription

[0031] Using lotus root total RNA as a template, using SPLVR3-1 primer, and using reverse transcriptase as MLV to synthesize cDNA, the reverse transcription system is:

[0032]

[0033]

[0034] Gently flick the tube wall to mix well, after a little centrifugation, keep warm at 42°C for 60 minutes, and then put it on ice for use;

[0035] ②PCR amplification

[0036] The PCR reaction system is as follows:

[0037]

[0038] The PCR program is: pre-denaturation at 94°C for 5 min; denaturation at 94°C f...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a detection kit for new potyviridae virus in nelumbo nucifera. The detection kit comprises two specific primers, and also comprises M-MLV reverse transcriptase, an M-MLV enzyme reaction buffering solution, dNTPs, Taq, DNA polymerase, Mg<2+> and a PCR reaction buffering solution. The invention also provides a detecting method for the new potyviridae virus in the nelumbo nucifera. The detecting method comprises the following steps: (1) extracting total RNA of a sample to be detected; (2) designing and synthesizing primers; (3) performing RT-PCR; (4) performing electrophoresis detection. The invention provides the detection kit and the detecting method for the new potyviridae virus in the nelumbo nucifera; the new potyviridae virus in the nelumbo nucifera is detected by adopting an RT-PCR method; cumbersome steps for separating nucleic acid of a virus of the nelumbo nucifera are avoided; time is shortened; the operability, the flexibility and the repeatability of the detection are greatly improved; an effective method is provided for the prevention and the treatment of the new potyviridae virus and the detection of a virus-free seedling.

Description

technical field [0001] The invention belongs to the technical field of plant virus detection, and in particular relates to a detection kit and a detection method for a new potato Yviridae virus in lotus root. Background technique [0002] Lotus root (Nelumbo nucifera) is a large perennial aquatic herb of the family Nymphaeaceae. It is native to China and India and has a cultivation history of more than 3,000 years. It can be divided into lotus root, seed lotus and flower lotus in production. Lotus root is rich in starch, protein, vitamins, minerals and other nutrients. It is the main aquatic vegetable in southern my country, and its cultivation area is nearly 333,000 hm2. [0003] In the previous research of our laboratory, we found that the typical wind wheel-shaped inclusion body structure of potyviridae virus was found in stiff lotus root, which indicated that there was some kind of poty virus infection in lotus root. In 2016, we extracted small RNA from lotus root leave...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/70C12Q1/68C12R1/94
CPCC12Q1/686C12Q1/701C12Q2521/107C12Q2565/125
Inventor 贺振刘娴董婷婷朱延达陈春峰李良俊
Owner YANGZHOU UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com