Detection kit and detecting method for new potyviridae virus in nelumbo nucifera
A technology for detection kits and detection methods, applied in the direction of microorganism-based methods, biochemical equipment and methods, and microbial measurement/inspection, can solve the problems of lack of genome sequence, unclear host range, and inability to use detection, etc., to achieve Effects of saving time, overcoming cumbersome steps, and improving operability
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment
[0024] (1) Primer design and synthesis
[0025] According to the results of high-throughput sequencing analysis of lotus root small RNA, a specific primer for the new Potatoviridae virus was designed and synthesized: SPLVF2-1 (GAATCGTATCAATCCTTGAG)
[0026] and SPLVR3-1 (GCTTCTGCGACATCACTAAAG);
[0027] (2) Extraction of total RNA
[0028] Polysaccharide and polyphenol plant tissue lysis method
[0029] (3) RT-PCR
[0030] ① cDNA synthesis by reverse transcription
[0031] Using lotus root total RNA as a template, using SPLVR3-1 primer, and using reverse transcriptase as MLV to synthesize cDNA, the reverse transcription system is:
[0032]
[0033]
[0034] Gently flick the tube wall to mix well, after a little centrifugation, keep warm at 42°C for 60 minutes, and then put it on ice for use;
[0035] ②PCR amplification
[0036] The PCR reaction system is as follows:
[0037]
[0038] The PCR program is: pre-denaturation at 94°C for 5 min; denaturation at 94°C f...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com