Recombinant lactic acid bacteria vaccine strain for constitutive expression rabbit hemorrhagic disease virus VP60 protein as well as preparation method and application of recombinant lactic acid bacteria vaccine strain
A technology of rabbit viral hemorrhage and constitutive expression, applied in the field of medicine, can solve the problems of high production cost, low expression of target protein, hidden dangers of biological safety, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0058] Embodiment 1 expresses the construction of RHDV-VP60 recombinant lactic acid bacteria
[0059] 1. Construction of plasmid pMD19-VP60
[0060] The total RNA of rabbit viral hemorrhagic disease disease material was extracted by viral genome RNA commercial kit, cDNA was synthesized by reverse transcription kit, and the VP60 gene of rabbit viral hemorrhagic disease virus was amplified by PCR method (the upstream primer was GAGCTC ATGGAGGGCAAAACCCGCACAGCGC, containing SacI restriction site; the downstream primer is GGGCCC TCAGACATAAGAAAGCCATTGGCT, containing ApaI restriction site). PCR reaction system (50 μL): 5 μL of 10×ETaqPCR Buffer, 0.5 μL of ETaq enzyme, 5 μL of cDNA template, 2 μL of primer pair, 4 μL of dNTP, and 33.5 μL of deionized water. The PCR reaction conditions were: 95°C for 5 min; 30 cycles of 94°C for 30 sec, 55°C for 30 sec, and 72°C for 1 min; 72°C for 10 min. After the PCR product of the target gene VP60 was recovered by gel, sequenced correctly, it ...
Embodiment 2
[0070] Expression and identification of embodiment 2 target protein
[0071] 2.1 Western blot identification of EGFP expression
[0072]The recombinant lactic acid bacteria pPG-T7g10-EGFP-VP60 / L.casei 393' prepared in Example 1 was cultured overnight, and the bacteria were collected by centrifugation at 12000rpm and lysed. Anti-EGFP monoclonal antibody and HRP-labeled goat anti-mouse IgG, the results showed that specific immunoblotting appeared at the expected position of the expressed protein ( Figure 5 : lane 1-2), the control group did not appear ( Figure 5 : lanes 3-4).
[0073] 2.2 Fluorescence microscopy to identify the expression of EGFP
[0074] Cultivate the recombinant lactic acid bacteria pPG-T7g10-EGFP-VP60 / L.casei 393' prepared in Example 1 overnight, collect the bacteria by centrifugation at 12000rpm, wash the bacteria three times with sterile PBS, spread the bacteria on a glass slide, and use After being fixed in acetone, observe under a fluorescent micros...
Embodiment 3
[0079] Example 3 Immunogenicity evaluation of recombinant lactic acid bacteria pPG-T7g10-EGFP-VP60 / L.casei 393'
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More