Method for cultivating transgenic rice based on RNAi binary vector

A technology of transgenic rice and binary vectors, applied in genetic engineering, recombinant DNA technology, botany equipment and methods, etc., can solve problems such as human health and environmental hazards, improve inhibition efficiency, eliminate food safety concerns, and significantly economic value effect

Inactive Publication Date: 2017-12-08
JILIN BUSINESS & TECH COLLEGE
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although no research has yet confirmed that genetically modified crops have potential safety hazards, some people worry about whether this situation will bring harm to human health and the environment due to the possible introduction of foreign genes during the genetically modified process.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for cultivating transgenic rice based on RNAi binary vector
  • Method for cultivating transgenic rice based on RNAi binary vector

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] Embodiment 1 vector construction

[0030] 1. Rice genome extraction

[0031] Using the high-salt method to extract rice genomic DNA, cut out 1 g of rice (Nipponbare) tissue, grind it with liquid nitrogen, add 30 μL of DNA extraction solution, incubate in a water bath at 65°C for 12 minutes, add 30 μL (25:24:1 toluene:chloroform:isoamyl alcohol), Centrifuge to get the supernatant, add 250 μL isoamyl alcohol to shake and centrifuge, remove the phase, add 500 μL 75% ethanol, wash and centrifuge, add 20 μL TE buffer, and store at 4 °C.

[0032] 2. Primer Design

[0033] We selected some exon genes of Csn5 gene to design primers to obtain target gene fragments for constructing RNAi vectors. After adding Nco1 and Sal1 restriction endonucleases and protective bases, the primer sequence:

[0034] P1 is: CCCATGGGGAAGGTTGGAGAATGTGGTT;

[0035] P2 is: GCGTCGACACACCAAAAATCTTCTATCTTG;

[0036] 3. Using the above primers and the rice genome as a template, amplify the partial exo...

Embodiment 2

[0051] Example 2 Agrobacterium transfection

[0052] 1. Preparation and transformation of Agrobacterium competent cells

[0053] 1.1 Preparation of Agrobacterium Competent Cells

[0054] 1.1.1 Pick a single clone of Agrobacterium or pipette 50 μL of the preserved Agrobacterium solution into 5ml YEP (containing 50mg / LKan) culture solution, 28°C, 250rpm shaking culture for 24h to the OD of the bacteria solution 600 is 1.5;

[0055] 1.1.2 Transfer 2mL of the above bacterial solution to 200mL YEB (containing 25μg / ml rifampicin), culture at 200rpm, shaker at 28°C for 4 hours to OD 600 reach about 0.5;

[0056] 1.1.3 Transfer to a sterile centrifuge tube, centrifuge at 5000rpm for 5min, and discard the supernatant;

[0057] 1.1.4 Add 10mL of pre-cooled 0.1M CaCl 2 solution, gently suspend the cells, and place on ice for 20 min. Centrifuge at 5000rpm at 4°C for 5min, discard the supernatant;

[0058] 1.1.5 Add 5 mL of pre-cooled 0.1M CaCl containing 15% glycerol 2 solution, g...

Embodiment 3

[0064] Embodiment 3 transgenic rice cultivation

[0065] 1. Bacteria removal and hygromycin screening

[0066] Wash the co-cultured callus with sterile water for 4-5 times, then sterilize it with a medium containing Amp (500 mg / L), shake it on a shaker for about 15 minutes, and then use sterile filter paper to remove the callus. The tissue was blotted dry, placed on the screening medium (Hyg 30mg / L) for screening, about 20d, subcultured once every 10d;

[0067] 2. Differentiation

[0068] Transfer the resistant callus sifted out on the screening medium to the differentiation medium (Hyg 20mg / L) for differentiation, about 20d, subculture once every 10d;

[0069] 3. Rooting

[0070] The resistant callus that differentiated into green seedlings is about 1 cm, and transferred to the rooting medium for rooting, and a well-developed root system can grow in about 7 days;

[0071] 4. Seedling hardening

[0072] Put the seedlings in a fresh-keeping bag to carry out the adaptabilit...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a method for cultivating transgenic rice based on an RNAi binary vector, and belongs to the technical field of rice genetic engineering. Selection and cloning of target fragments, construction of palindromic sequences of target fragments, selection of cloning systems and construction of RNAi recombinant plasmids, Agrobacterium transformation of RNAi recombinant plasmids, Agrobacterium-mediated transformation and rice tissue culture, detection of transgenic rice, transgenic Stress resistance analysis of plants. The invention utilizes RNAi technology to effectively reduce the expression of rice Csn5 gene, can be used to breed rice transgenic strains with certain resistance, and provides technical support for crop variety improvement and application in agricultural molecular breeding.

Description

technical field [0001] The invention belongs to the technical field of rice genetic engineering, and in particular relates to a method for reducing rice Csn5 gene expression by using RNAi technology and establishing relatively safe transgenic rice plants. Background technique [0002] All aspects of human life are closely related to agriculture, which is an important material basis for human reproduction. For thousands of years, humans have improved the quality of agricultural products through continuous improvement of agricultural technology to meet the growing demand of human society for food and other necessities. In recent years, the population of the world has increased rapidly, and the area of ​​arable land has been continuously reduced due to environmental degradation. How to use the limited area of ​​arable land to produce enough food has become a worldwide problem. After long-term development, traditional breeding technology has reached a very high level, but at th...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/82A01H5/00
CPCC12N9/6416C12N15/8218C12N15/8273C12Y304/24
Inventor郭立泉刘东吴铭徐淼
OwnerJILIN BUSINESS & TECH COLLEGE