Related proteins, coding genes and applications for controlling temperature-sensitive male sterility in wheat
A technology of male sterility and related proteins, applied in the field of genetic engineering, can solve the problems of BS366 obstacles and not knowing where the key nodes are, and achieve the effect of increasing yield and accelerating the process of stress-resistant molecular breeding
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0022] Cloning and sequence motif analysis of embodiment 1, TMS1 gene
[0023] BS366 was planted in the fields of Beijing (high temperature 20°C) and Anhui Fuyang (low temperature 10°C). Mature pollen stage (MP) was quickly frozen in liquid nitrogen and stored at -80°C for later use. According to the RNA extraction kit (Beijing Tiangen Biochemical Technology Co., Ltd.), the total RNA extraction of plant leaf tissue was completed, and then the extracted total RNA was used as a template, and the TMS1-F / R sequence was used as a primer, and reverse transcriptase (M- MLV) for reverse transcription to obtain cDNA templates for subsequent experiments. Design a pair of primers:
[0024] TMS1-F GTCCCTGCTGTGATATCAAGAGC
[0025] TMS1-R CAGGGCAGGTCAGTTCTTGG
[0026] The present invention obtains the gene TMS1, the TMS1 open reading frame (ORF) has a length of 711bp and encodes 236 amino acids. The gene is a gene family encoding Ole e 1 pollen protein, and TMS1 is the member of the Ole...
Embodiment 2
[0027] Example 2: TMS1 expression characteristics in BS366 stamens under fertile and sterile environments
[0028] The wheat sterile line BS366 was induced under fertile (20°C) and sterile (10°C) environments, at the pollen mother cell stage (PMC), dyad (Dyad), tetrad stage (Tetrad) and Samples were taken at the mature pollen stage (MP), and the RNA of the above-mentioned stress-treated materials was reverse-transcribed into cDNA. As a template, RT-PCR was used to analyze the stamen-specific expression genes in the pistil differentiation stage, connective formation stage, and meiosis stage. And the expression pattern of mononucleate stage, and compared with the expression pattern of common wheat variety JING411, to verify the expression pattern of TMS1 under environmental induction. like figure 1 As shown, there was no significant difference in expression of TMS1 in common wheat under fertile and sterile environments; however, there was a significant difference in BS366 under...
Embodiment 3
[0029] Example 3: Functional identification of thermosensitive male sterility in TMS1 transgenic wheat
[0030]Using the cDNA sequence of wheat TaPollen1-D as a template, avoiding its conserved domain, try to select three homologous segments of TMS1 gene, select a fragment of about 350bp, and add a rice intron sequence and 350bp sequence to its 3' end The reverse complementary sequence of the whole gene synthesis (Hua Da Genomics Company, Beijing). After analyzing the restriction sites of the sequence, add restriction sites BamHI and SacI to both ends of the sequence, then perform double digestion on the pCAMBIA3300 vector and the synthetic fragment, and then make a connection to construct the synthetic reverse complementary sequence to pCAMBIA3300 on the carrier. The constructed vector was transformed into Agrobacterium EHA105, and the callus induced by young embryos of Spring wheat Fielder was transformed to obtain TMS1 silenced transgenic plants. Obtain transgenic lines o...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More