Anti-Ebola virus GP protein monoclonal antibody, and applications thereof

An Ebola virus and monoclonal antibody technology, applied in the field of biological immunology, can solve the problems of no treatment method, no legal and effective vaccine for Ebola disease, etc., and achieve the effect of high specificity and sensitivity

Inactive Publication Date: 2018-01-05
HUAZHONG AGRI UNIV
View PDF5 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there is still no legal and effective vaccine for Ebola disease, and there is no effective treatment

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Anti-Ebola virus GP protein monoclonal antibody, and applications thereof
  • Anti-Ebola virus GP protein monoclonal antibody, and applications thereof
  • Anti-Ebola virus GP protein monoclonal antibody, and applications thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] The preparation of embodiment 1 antigen

[0027] 1. PCR amplification of Ebola virus GP gene fragment

[0028] According to the Ebola virus GP gene sequence (GenBank accession number: AF086833), DNA STAR software was used to analyze the immunogenicity, hydrophilicity and surface accessibility of GP, and the results found that the hydrophilicity and antigenic index of 1-300 amino acid fragments Higher, so choose the gene sequence design primer of 1-300 amino acid, with the expression plasmid that contains whole GP gene as template, design a pair of primers (upstream primer: GCGGATCCATGGGCGTTACAGGAATATT; Downstream primer: CGAGCTCTTCATTTTTCTAGTGAGGTT;), respectively introduce BamH I and Sac I sites. The target gene sequence was obtained by PCR amplification.

[0029] The reaction system is shown in Table 1 and Table 2.

[0030] Table 1 PCR reaction system

[0031]

[0032] Table 2PCR reaction conditions

[0033]

[0034]

[0035] 2. Construction of Ebola vir...

Embodiment 2

[0041] The preparation of embodiment 2 monoclonal antibody

[0042] 1. Mice Immunization

[0043] Six 6-week-old female SPF BALB / c mice (purchased from Hubei Provincial Center for Disease Control and Prevention) were selected. Take 100 μg of the truncated GP protein immunogen prepared in Example 1, which is easily emulsified with an equal volume of complete Freund's adjuvant (purchased from sigma company), and injected subcutaneously in the back of the mouse for the first immunization. After 14d and 28d, the same dose was emulsified with an equal volume of incomplete Freund's adjuvant (purchased from sigma) for the second and third immunizations. On the 14th day after the third immunization, the mice in the immune group and the blank group were docked to collect blood, and the serum was separated, and the indirect ELISA method was used (Engvall, E. (2010). The ELISA, enzyme-linkedimmunosorbent assay. Clin Chem, 56 (2), 319-320.doi:10.1373 / clinchem.2009.12780.) Detection of m...

Embodiment 3

[0055] The genetic stability detection of embodiment 3 hybridoma cells

[0056] After the clone of the hybridoma cell line was purified, it was inoculated on a 24-well cell culture plate and cultured. When the cells grew to the logarithmic growth phase, colchicine with a final concentration of 0.4 mg / mL was added to the cell supernatant, 37°C, 5 %CO 2 Cultivate in the cell culture incubator for 3 hours; gently blow the cells with a decapitated pipette to suspend the cells, aspirate the cell suspension, and centrifuge at 1000r / min in a 4mL EP tube for 10min; add 1mL of 0.075mol / L KCl preheated at 37℃ Infiltrate the solution, gently resuspend the cells, place the cell suspension in a 37°C incubator and let it stand for 30min; add 1mL of freshly prepared fixative solution (methanol: glacial acetic acid volume ratio = 3:1), mix well, and centrifuge at 1000r / min for 10min , discard the supernatant; then add 1mL of fixative, mix gently, let stand in a 37°C incubator for 30min, cent...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of biological immunology, and more specifically relates to an anti-Ebola virus GP protein monoclonal antibody, and applications thereof. The anti-Ebola virus GP protein monoclonal antibody is secreted by a hybridoma cell strain with a preservation number of CCTCC NO:C2016106. The invention also discloses a preparation method and applications of the anti-Ebola virus GP protein monoclonal antibody. The anti-Ebola virus GP protein monoclonal antibody is high in specificity and biological binding activity, is capable of reacting with sf9 cells infectedby recombinant baculovirus containing GP gene, and is not reacted with normal sf9 cells, so that the anti-Ebola virus GP protein monoclonal antibody can be used for preparation of kits used for detecting Ebola virus GP protein and immunoassay.

Description

technical field [0001] The invention relates to the technical field of biological immunology. It specifically relates to a monoclonal antibody against Ebola virus GP protein and its application. The Ebola virus monoclonal antibody is from mouse source. The monoclonal antibody has high specificity and sensitivity to the Ebola virus GP protein, and can be applied to the preparation of Ebola virus GP protein detection reagents. The present invention is for subsequent humanized transformation, develops a neutralizing antibody that neutralizes Ebola virus, and lays a material foundation for later development into an antibody for clinical treatment of Ebola virus disease. Background technique [0002] Ebola virus disease (EVD) is a severe zoonotic disease with high mortality caused by Ebola virus (EBOV). The Ebola virus spreads from animal to animal, human to human, and animal to human, and has repeatedly caused major animal and human harm on the African continent. Among them,...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/40C07K14/08C07K16/10C12N5/20G01N33/68G01N33/577G01N33/569
Inventor曹胜波余慕川黄小梅刘学芹叶静聂艳如
OwnerHUAZHONG AGRI UNIV