Unlock instant, AI-driven research and patent intelligence for your innovation.

Tumor acidity responsive autophagy-induced polypeptide as well as preparation method and application thereof

An acidity-responsive and autophagy technology, applied in biochemical equipment and methods, anti-tumor drugs, chemical instruments and methods, etc., can solve the problems of limited application, lack of tissue specificity, poor in vivo stability, etc. High rate and strong antitumor activity

Active Publication Date: 2018-02-13
SHANXI UNIV
View PDF3 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, Beclin 1 itself cannot enter cells, lacks tissue specificity and has poor stability in vivo, which greatly limits its application in tumor therapy

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Tumor acidity responsive autophagy-induced polypeptide as well as preparation method and application thereof
  • Tumor acidity responsive autophagy-induced polypeptide as well as preparation method and application thereof
  • Tumor acidity responsive autophagy-induced polypeptide as well as preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0021] Example 1: Construction of Fusion Protein Particles

[0022] Chemical synthesis of pHLIP-Beclin 1 gene sequence

[0023] GGATCCGCGGCGGAACAGAACCCGATTTATTGGGCGCGCTATGCGGATTGGCTGTTTACCACCCCGCTGCTGCTGCTGGATCTGGCGCTGCTGGTGGATGCGGATGAAGGCACCTGCGGCACCAACGTGTTTAACGCGACCTTTCATATTTGGCATAGCGGCCAGTTTGGCACCTAACT CGAG, and at the two ends of the target protein gene sequence were designed BamH I and Xho enzyme cutting sites. Then, the target protein gene is connected into the pET-32a vector through the above-mentioned restriction site, so as to obtain the target protein expression vector. (See figure 1 and 2)

Embodiment 2

[0024] Embodiment 2: Expression and purification of fusion protein

[0025] (1) Expression of fusion protein

[0026] The above fusion protein expression vector was transformed into BL21(DE3) Escherichia coli, and 50 μL of bacterial liquid was added to 5 mL of LB liquid medium, and cultured on a shaking table at 37° C. at 200 rpm for 8 hours. The bacterial liquid was transferred to 500 mL LB liquid medium, cultivated to OD=0.6-0.8 at 37° C., 200 rpm, and induced to express overnight with IPTG (1 mM) at 16° C., 200 rpm. (See image 3 )

[0027] (2) Purification of fusion protein

[0028] Centrifuge (8000rpm, 10min) the above-mentioned IPTG-induced bacterial solution, discard the supernatant, and harvest the bacteria. The precipitate was blown away with 10 mM PBS (pH=7.4) solution, sonicated, centrifuged at 13000 rpm for 20 min, and the supernatant was collected. The supernatant was purified by Ni ion affinity chromatography. After the total protein was fully adsorbed, the ...

Embodiment 3

[0029] Example 3: Crystal violet staining method to detect the effect of autophagy-inducing polypeptide on cell proliferation

[0030] MCF-7 cells in the exponential growth phase were treated with 5×10 3 per well into a 96-well culture plate at 37°C with 5% CO 2 After incubation in the incubator for 24 hours, different concentrations of tagged protein Trx, Beclin 1, and fusion protein were added to the fresh culture medium at pH=7.4 / 6.5 to the final concentrations of 0 μM, 10 μM, 50 μM, and 100 μM, and five replicates were set for each concentration. hole. After incubation for 24 hours, the liquid in the wells was aspirated, washed twice with PBS buffer, and 50 μL of 0.5% crystal violet solution was added to each well. After staining at room temperature for 20 min, the liquid in the wells was aspirated, lightly washed twice with PBS buffer, and washed with BioTek Cytation 5. Hole imager, observed under 4x microscope. After observation, 200 μL of methanol solution was added to...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides tumor acidity responsive autophagy-induced polypeptide as well as a preparation method and application thereof. The preparation method comprises the following steps: chemicallysynthesizing gene sequences of pH low insertion peptide (pHLIP) and Beclin 1 active fragments and connecting the sequences to a pET-32a expression vector through a restriction enzyme cutting site to obtain a recombinant plasmid; converting the recombinant plasmid to escherichia coli BL-21(DE3) and obtaining engineering bacteria pET-32a-pHLIP-Beclin 1 / BL21(DE3) through screening; performing IPTG induced expression on the engineering bacteria, collecting thalli and obtaining target proteins through separation and purification. The tumor acidity responsive autophagy-induced polypeptide provided by the invention can be positioned to a tumor acidic microenvironment through pHLIP; the Beclin 1 active fragment is conveyed to tumor cells in a targeted manner, so that the tumor cells are induced togenerate autophagic death; the tumor acidity responsive autophagy-induced polypeptide can be applied to the preparation of a targeted anti-cancer drug.

Description

technical field [0001] The invention relates to the field of biotechnology and pharmaceuticals, in particular to a tumor acidity-responsive autophagy-inducing polypeptide, a preparation method thereof, and an application of the polypeptide in the preparation of targeted anticancer drugs. Background technique [0002] Beclin 1 plays an important role in the occurrence and development of tumors through the regulation of autophagy. Currently, Beclin 1 has been identified as a new tumor suppressor gene. However, it is reported that 75% of ovarian cancers, 50% of breast cancers and 40% of prostate cancers have deletion mutations of Beclin 1 gene, the expression of Beclin 1 protein decreases, and the function of autophagy decreases. Therefore, if the expression of Beclin 1 in these tumor patients can be enhanced to start the autophagy process, the tumor cells will die due to excessive autophagy, thereby achieving the purpose of inhibiting tumor growth. However, Beclin 1 itself c...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K19/00C12N15/62C12N15/70C12N1/21A61K38/17A61K47/42A61P35/00C12R1/19
CPCA61K38/00C07K14/4747C07K2319/01C07K2319/35C12N15/62C12N15/70
Inventor 丁国斌李卓玉孙俊清杨鹏李彬春
Owner SHANXI UNIV