A kind of bifunctional ion chelating magnetic carrier and its application

A magnetic carrier, dual-function technology, applied in the directions of immobilization on or in inorganic carriers, immobilization on/in organic carriers, carrier binding/immobilization of peptides, etc. Separation, expensive reagents and other problems, to achieve the effect of strong tolerance, no non-specific adsorption, small pore size distribution

Active Publication Date: 2020-09-18
SHENYANG AGRI UNIV
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Ni-NTA also has many disadvantages: the reagents used in this method are expensive, the specificity is weak, and there are many foreign proteins in the purification process (Zhou H, Li JX, Xie SY, Zang MX. Expression and purification of the outer shell protein VP2 of the 4th serotype Bluetongue virus, and preparation of monoclonal antibodies against this protein. Process Biochem. 2017; 61:119-123.)
The application of xylanase mostly adopts the form of free enzyme catalysis, so in the application process, the free enzyme has the disadvantages of poor stability, difficulty in repeated use, and difficult separation of enzyme and product, so the application of xylanase is limited to a certain extent

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of bifunctional ion chelating magnetic carrier and its application
  • A kind of bifunctional ion chelating magnetic carrier and its application
  • A kind of bifunctional ion chelating magnetic carrier and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0046] Example 1: Cloning and Expression of Xylanase Genes in Metagenomes

[0047] 1) Construction of PANY2-Xylanase

[0048] Using the metagenome total DNA from the soil under the botanical garden of Shenyang Agricultural University as a template, using Taq DNA polymerase, XY11-F (5'-TTAAC TTTAA GAAGG AGATA TACAT ATGAC GATCC AACCA GGCAC NGGNTACAAY AAY-3') and XY11-R (5'-GCTCT TAGTG GTGGT GGTGG TGGTG GTCGA CGCTAACGGT GATGCTNGCA GANCC NCT-3') is a primer to amplify the Xylanase gene in soil. Using the PANY2 plasmid as a template, using PfuDNA polymerase, PANY2-For(5'-GTCGA CCACC ACCAC CACCA CCACTAAGAG CTCCT GCAGT TGGCTGCTGC CACCG C-3') and PANY2-Rev(5'-ATGTA TATCT CCTTC TTAAA GTTAA ACAAA ATTATTTCTAGAGGGAAACC GTTGT G -3') is the primer to amplify the PANY2 vector. The fragments amplified above were ligated by recombinase and then transformed into Escherichia coli JM109 to obtain PANY2-Xylanase.

[0049] 2) Expression of PANY2-Xylanase xylanase

[0050] The obtained positive ...

Embodiment 2

[0053] Example 2: Preparation of protein purification / immobilization bifunctional ion-chelating magnetic carrier based on curdlan

[0054] 1) Fe 3 o 4 Preparation of Nanoparticles: According to Fe 3+ : Fe 2+ =1.75:1.00 ratio, add 35mL0.5mol / L FeCl respectively 3 and 20mL of 0.5mol / L FeCl 2 Put the solution in a beaker, stir and mix well, put it in a 50°C water bath, quickly drop in 2mol / L ammonia solution to adjust the pH of the solution to pH 10.0±0.2, the liquid turns from brown to black, raise the temperature to 80°C and keep it at a constant temperature for 1h, then with ddH 2 O washed several times, adsorbed by a strong magnet, discarded the supernatant, and finally stored the magnetic fluid at 4°C ddH 2 Reserved in O.

[0055] 2) Preparation of magnetic curdlan microspheres: prepared by reverse embedding method. Oil phase: add 36mL toluene and 14mL chloroform to a three-necked flask and mix well, add 0.5mL Span-80 and mix well, preheat to 55°C. Water phase: heat...

Embodiment 3

[0059] Example 3: Curdlan-based protein purification / immobilization bifunctional ion-chelating magnetic carrier directional immobilization of xylanase

[0060] Accurately weigh 10.0 mg of the protein purification / immobilization bifunctional ion-chelating magnetic carrier based on curdlan gum in a 50 mL Erlenmeyer flask, add 10 mL of 1.5 mg / mL xylanase solution (dissolved in 0.1 mol / L pH 5.0 phosphate buffer), shaking at room temperature for 4 hours, and washing with 0.1 mol / L acetic acid-sodium acetate buffer solution several times until no free enzyme was detected in the supernatant, and the immobilized xylanase was obtained. And the immobilization conditions and immobilization effect of the immobilized enzyme were studied.

[0061] 1) The amount of enzyme immobilized by the protein purification / immobilization bifunctional ion chelating magnetic carrier based on curdlan gum was determined:

[0062]The formula for calculating the solid load is:

[0063]

[0064] In the fo...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention belongs to the technical field of enzyme purification and immobilization, and more specifically relates to a curdlan-based protein purifying / immobilizing difunctional ion chelated magnetic carrier, and applications thereof. The difunctional ion chelated magnetic carrier is obtained via activation and chelating of magnetic curdlan microspheres, and possesses immobilizing and purifyingfunctions; according to magnetic curdlan microspheres, Fe3O4 nanoparticles are taken as a core, a shell is obtained via curdlan reverse embedding, and the difunctional ion chelated magnetic carrier is obtained via synthesis. The difunctional ion chelated magnetic carrier possesses magnetic responsibility; in applications, column separation is not needed, separation of the difunctional ion chelated magnetic carrier from a reaction system can be realized easily under the action of an applied magnetic field, and one-step elution and recycling can be realized rapidly and conveniently. The difunctional ion chelated magnetic carrier is capable of playing an important role in the fields such as enzyme immobilization and enzyme purification because applications are convenient and high in efficiency; the stability and catalytic efficiency of xylanase obtained via immobilization using the difunctional ion chelated magnetic carrier are increased obviously, production cost is reduced, and large scale industrialized production is promising to realize.

Description

technical field [0001] The invention belongs to the technical field of enzyme purification and immobilization, and specifically relates to a protein purification / immobilization bifunctional ion chelating magnetic carrier based on curdlan gum and its application. Background technique [0002] Curdlan gum (Curdlan) is a new type of microbial exopolysaccharide. The long-term toxicity test of Curdlan gum shows that it is safe and non-toxic to the human body (Spicer EJF, Goldenthal EI, IkedaTA.Toxicological assessment of curdlan .Food Chem Toxicol.1999; 37(4):455-479.), and curdlan gum has many special physical and chemical properties, can be dissolved in alkaline aqueous solution, but insoluble in water, these characteristics make it in the food industry , was approved by the U.S. FDA in 1996 to be used as a food stabilizer and thickener in food ingredients (Demleitner S, Kraus J, Franz G.Synthesis and antitumour activity ofsulfoalkyl derivatives of curdlan and lichenan.Carbohy ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12N11/14C12N11/10C12N11/04C07K17/14C07K17/10C07K17/04
CPCC07K17/04C07K17/10C07K17/14C12N9/248C12N11/04C12N11/10C12N11/14
Inventor 安迎锋张艺峰高嵩高何瑞许淑敏刘霞刘一菲张铮泽哈基
Owner SHENYANG AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products