Difunctional ion chelated magnetic carrier, and applications thereof
A magnetic carrier and dual-functional technology, applied in the direction of immobilization on or in inorganic carriers, immobilization on/in organic carriers, carrier binding/immobilization of peptides, etc., can solve the difficult separation of enzymes and products, and the stability of free enzymes Poor performance, expensive reagents and other problems, to achieve the effect of no non-specific adsorption, strong tolerance, small pore size distribution range
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0046] Example 1: Cloning and Expression of Xylanase Genes in Metagenomes
[0047] 1) Construction of PANY2-Xylanase
[0048] Using the metagenome total DNA from the soil under the botanical garden of Shenyang Agricultural University as a template, using Taq DNA polymerase, XY11-F (5'-TTAAC TTTAA GAAGG AGATA TACAT ATGAC GATCC AACCA GGCAC NGGNTACAAY AAY-3') and XY11-R (5'-GCTCT TAGTG GTGGT GGTGG TGGTG GTCGA CGCTAACGGT GATGCTNGCA GANCC NCT-3') is a primer to amplify the Xylanase gene in soil. Using the PANY2 plasmid as a template, using PfuDNA polymerase, PANY2-For(5'-GTCGA CCACC ACCAC CACCA CCACTAAGAG CTCCT GCAGT TGGCTGCTGC CACCG C-3') and PANY2-Rev(5'-ATGTA TATCT CCTTC TTAAA GTTAA ACAAA ATTATTTCTAGAGGGAAACC GTTGT G -3') is the primer to amplify the PANY2 vector. The fragments amplified above were ligated by recombinase and then transformed into Escherichia coli JM109 to obtain PANY2-Xylanase.
[0049] 2) Expression of PANY2-Xylanase xylanase
[0050] The obtained positive ...
Embodiment 2
[0053] Example 2: Preparation of protein purification / immobilization bifunctional ion-chelating magnetic carrier based on curdlan
[0054] 1) Fe 3 o 4 Preparation of Nanoparticles: According to Fe 3+ : Fe 2+ =1.75:1.00 ratio, add 35mL0.5mol / L FeCl respectively 3 and 20mL of 0.5mol / L FeCl 2 Put the solution in a beaker, stir and mix well, put it in a 50°C water bath, quickly drop in 2mol / L ammonia solution to adjust the pH of the solution to pH 10.0±0.2, the liquid turns from brown to black, raise the temperature to 80°C and keep it at a constant temperature for 1h, then with ddH 2 O washed several times, adsorbed by a strong magnet, discarded the supernatant, and finally stored the magnetic fluid at 4°C ddH 2 Reserved in O.
[0055] 2) Preparation of magnetic curdlan microspheres: prepared by reverse embedding method. Oil phase: add 36mL toluene and 14mL chloroform to a three-necked flask and mix well, add 0.5mL Span-80 and mix well, preheat to 55°C. Water phase: heat...
Embodiment 3
[0059] Example 3: Curdlan-based protein purification / immobilization bifunctional ion-chelating magnetic carrier directional immobilization of xylanase
[0060] Accurately weigh 10.0 mg of the protein purification / immobilization bifunctional ion-chelating magnetic carrier based on curdlan gum in a 50 mL Erlenmeyer flask, add 10 mL of 1.5 mg / mL xylanase solution (dissolved in 0.1 mol / L pH 5.0 phosphate buffer), shaking at room temperature for 4 hours, and washing with 0.1 mol / L acetic acid-sodium acetate buffer solution several times until no free enzyme was detected in the supernatant, and the immobilized xylanase was obtained. And the immobilization conditions and immobilization effect of the immobilized enzyme were studied.
[0061] 1) The amount of enzyme immobilized by the protein purification / immobilization bifunctional ion chelating magnetic carrier based on curdlan gum was determined:
[0062]The formula for calculating the solid load is:
[0063]
[0064] In the fo...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


