Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Novel T cell immune modulator bioactivity detection method

A technology of biological activity and detection method, which is applied in the field of biomedicine, can solve the problems of high cost, large variability, and long time required, and achieve the effects of simple operation, high positive rate, and efficient integration

Active Publication Date: 2018-04-17
BEIJING DONGFANG BIOTECH
View PDF2 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

These traditional methods have the disadvantages of long time required, high cost, and the method itself is easily affected by the difference in PBMC activity between different human bodies, and the variability is large.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Novel T cell immune modulator bioactivity detection method
  • Novel T cell immune modulator bioactivity detection method
  • Novel T cell immune modulator bioactivity detection method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0055] Example 1: Construction of Sleeping Beauty transposon dual-plasmid system

[0056] 1. Construction of pGL4.15-IL-2P reporter gene vector and construction of pGL4.15-NFAT reporter gene vector

[0057] (1) Whole gene synthesis IL-2 promoter (-329 to +48 position), wherein upstream has KpnI restriction site GGTACC, downstream band HindIII restriction site AAGCTT, IL-2 promoter (-329 to + 48 bits) The full sequence is as follows:

[0058] GGTACCGAAAATTTTCTGAGTTACTTTTGTATCCCCACCCCCTTAAAGAAAGGAGGAAAAACTGTTTCATACAGAAGGCGTTAATTGCATGAATTAGAGCTATCACCTAAGTGTGGGCTAATGTAACAAAGAGGGATTTCACCTACATCCATTCAGTCAGTCTTTGGGGGTTTAAAGAATTCCAAAGAGTCATCAGAAGAGGAAAAATGAAGGTAATGTTTTTTCAGACAGGTAAAGTCTTTGAAAATATGTGTAATATGTAAAACATTTTGACACCCCCATAATATTTTTCCAGAATTAACAGTATAAATTGCATCTCTTGTTCAAGAGTTCCCTATCACTCTCTTTAATCACTACTCACAGTAACCTCAACTCCTGCCACAAAGCTT。

[0059] The whole gene synthesis product and the pGL4.15 plasmid were digested with KpnI and HindIII, and the IL-2 promoter was inserted into the pGL4.1...

Embodiment 2

[0074] Example 2: IL-2 promoter drives the acquisition of luciferase stable cell lines and NFAT RE-driven luciferase stable cell lines

[0075] 1. Sleeping Beauty transposon system integrated reporter gene into Jurkat host cells

[0076] (1) Sleeping Beauty double-plasmid system transfection host cells

[0077] (1) Subculture Jurkat cells 1 day in advance;

[0078] (2) Add RPMI1640 growth medium + 10% bovine serum + 1% double antibody to two wells of a 6-well plate, 2ml / well, preheat in the incubator; take another 220ul Cell line Nucleofector Solution V in the incubator Preheat for 10 minutes;

[0079] (3) Take 5ug pGL4.15-IL-2P plasmid and 5ug pGL4.15-NFAT plasmid respectively in two EP tubes, and then add 0.5ug pcDNA3.1-SB11 plasmid to mix for later use;

[0080] (4) Turn on the Nucleofector electrotransfer instrument and select program X-001;

[0081] (5) Jurkat cell counting, 1 million cells were divided into two centrifuge tubes, centrifuged at 90g for 5min, and the s...

Embodiment 3

[0105] Embodiment 3: the test of biological activity of T cell activator

[0106] 1. Test of biological activity of CTLA4-Fc fusion protein

[0107] The IL-2P Luc-positive cell line positively correlated with IL2 and luciferase activity obtained through screening was selected as clone No. 6 for subsequent experiments. According to the cell density of 100,000 cells / well, the initial concentration of CTLA4-Fc was 67ug / ml, 10-fold serial dilution of 13 gradients, a total of 14 concentration points. CTLA4-Fc was used for 6 hours to detect luciferase activity.

[0108] Such as Image 6 As shown, after adding serially diluted CTLA4-Fc fusion protein, as the concentration of CTLA4-Fc increases, the fluorescence intensity gradually decreases, that is, the expression of IL-2 gradually decreases. It can be seen that with the increase of CTLA4-Fc concentration, The enhanced activity of inhibiting T cell activation indicates that the system can be used to quantitatively detect the biol...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of biological medicines, and particularly discloses a novel T cell immune modulator bioactivity detection method. Eukaryotic expression plasmids and co-expression resistance genes of sleeping beauty transposase and reporter genes driven by different response elements are expressed, eukaryotic expression plasmids of transposon inverted repetitive sequences are inserted into two ends of the reporter genes and the co-expression resistance genes and jointly transferred into host Jurkat T cells, pressurized screening and monoclonal separation are performed to obtain stable monoclonal effect cells, target cells and T cell activating modulators are added, and bioactivity of T cell immune modulator is measured by measuring activity of the reporter genes. The method can be applied to a bioactivity reporter gene detection system for cell immune modulators such as PD-1 / PD-L1 monoclonal antibodies and CTAL4-Fc fusion proteins. Any human blood-derived cell components or other components are omitted, testing results are stable, operation is simple and convenient, testing time is short, and the method is quite suitable for later drug quality control and batch release detection and can be widely applied.

Description

technical field [0001] The invention relates to the technical field of biomedicine, in particular to a biological activity detection method for establishing a T cell immune regulator using the Sleeping Beauty transposon system. Background technique [0002] Transposons, also known as mobile genes and jumping genes, are DNA sequences that can be inserted and excised in the genome and can change their position. As early as the 1950s, it was first discovered by McClintock in corn, and then successively found in bacteria, fungi, animals and plants, such as Tn5 in bacteria, Ty in yeast, and piggyBac transposon from Lepidoptera insects Wait. The Sleeping Beauty (SB) transposition system is a member of the Tc1 / mariner transposon superfamily, which has been inactive for more than 10 million years; in 1997, Ivics et al. Using scientific methods, molecular reconstruction was carried out on it, and finally its transposition activity was awakened, and its jumping ability was restored,...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/85C12Q1/6897
CPCC12N15/85C12N2800/107C12N2800/90C12Q1/6897
Inventor 文圣梅陈龙刘思艾林白义
Owner BEIJING DONGFANG BIOTECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com