Novel T cell immune modulator bioactivity detection method
A technology of biological activity and detection method, which is applied in the field of biomedicine, can solve the problems of high cost, large variability, and long time required, and achieve the effects of simple operation, high positive rate, and efficient integration
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0055] Example 1: Construction of Sleeping Beauty transposon dual-plasmid system
[0056] 1. Construction of pGL4.15-IL-2P reporter gene vector and construction of pGL4.15-NFAT reporter gene vector
[0057] (1) Whole gene synthesis IL-2 promoter (-329 to +48 position), wherein upstream has KpnI restriction site GGTACC, downstream band HindIII restriction site AAGCTT, IL-2 promoter (-329 to + 48 bits) The full sequence is as follows:
[0058] GGTACCGAAAATTTTCTGAGTTACTTTTGTATCCCCACCCCCTTAAAGAAAGGAGGAAAAACTGTTTCATACAGAAGGCGTTAATTGCATGAATTAGAGCTATCACCTAAGTGTGGGCTAATGTAACAAAGAGGGATTTCACCTACATCCATTCAGTCAGTCTTTGGGGGTTTAAAGAATTCCAAAGAGTCATCAGAAGAGGAAAAATGAAGGTAATGTTTTTTCAGACAGGTAAAGTCTTTGAAAATATGTGTAATATGTAAAACATTTTGACACCCCCATAATATTTTTCCAGAATTAACAGTATAAATTGCATCTCTTGTTCAAGAGTTCCCTATCACTCTCTTTAATCACTACTCACAGTAACCTCAACTCCTGCCACAAAGCTT。
[0059] The whole gene synthesis product and the pGL4.15 plasmid were digested with KpnI and HindIII, and the IL-2 promoter was inserted into the pGL4.1...
Embodiment 2
[0074] Example 2: IL-2 promoter drives the acquisition of luciferase stable cell lines and NFAT RE-driven luciferase stable cell lines
[0075] 1. Sleeping Beauty transposon system integrated reporter gene into Jurkat host cells
[0076] (1) Sleeping Beauty double-plasmid system transfection host cells
[0077] (1) Subculture Jurkat cells 1 day in advance;
[0078] (2) Add RPMI1640 growth medium + 10% bovine serum + 1% double antibody to two wells of a 6-well plate, 2ml / well, preheat in the incubator; take another 220ul Cell line Nucleofector Solution V in the incubator Preheat for 10 minutes;
[0079] (3) Take 5ug pGL4.15-IL-2P plasmid and 5ug pGL4.15-NFAT plasmid respectively in two EP tubes, and then add 0.5ug pcDNA3.1-SB11 plasmid to mix for later use;
[0080] (4) Turn on the Nucleofector electrotransfer instrument and select program X-001;
[0081] (5) Jurkat cell counting, 1 million cells were divided into two centrifuge tubes, centrifuged at 90g for 5min, and the s...
Embodiment 3
[0105] Embodiment 3: the test of biological activity of T cell activator
[0106] 1. Test of biological activity of CTLA4-Fc fusion protein
[0107] The IL-2P Luc-positive cell line positively correlated with IL2 and luciferase activity obtained through screening was selected as clone No. 6 for subsequent experiments. According to the cell density of 100,000 cells / well, the initial concentration of CTLA4-Fc was 67ug / ml, 10-fold serial dilution of 13 gradients, a total of 14 concentration points. CTLA4-Fc was used for 6 hours to detect luciferase activity.
[0108] Such as Image 6 As shown, after adding serially diluted CTLA4-Fc fusion protein, as the concentration of CTLA4-Fc increases, the fluorescence intensity gradually decreases, that is, the expression of IL-2 gradually decreases. It can be seen that with the increase of CTLA4-Fc concentration, The enhanced activity of inhibiting T cell activation indicates that the system can be used to quantitatively detect the biol...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com