Application of panicum virgatum L. S-adenosylmethionine synthase gene SAMS1 to regulation and control of lignin synthesis

A switchgrass and gene technology is applied in the field of transformation of switchgrass SAMS1 expression level to achieve the effect of increasing saccharification efficiency

Active Publication Date: 2018-06-08
QINGDAO INST OF BIOENERGY & BIOPROCESS TECH CHINESE ACADEMY OF SCI
View PDF5 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the regulation mechanism of methionine pathway on lignin has not been reported yet.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of panicum virgatum L. S-adenosylmethionine synthase gene SAMS1 to regulation and control of lignin synthesis
  • Application of panicum virgatum L. S-adenosylmethionine synthase gene SAMS1 to regulation and control of lignin synthesis
  • Application of panicum virgatum L. S-adenosylmethionine synthase gene SAMS1 to regulation and control of lignin synthesis

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0023] Example 1: PvSAMS1 Gene cloning and sequencing

[0024] First, we base our research on rice SAMS research background (Li et al., Knockdown of SAMSgenes encoding S-adenosyl -L-methionine synthetases causes methylation alterations of DNAs and histones and leads to late flowering in rice. 2011, JPlant Physiol, 168: 1837-1843), searched the switchgrass database for the whole genome, obtained switchgrass SAMS candidate genes, and constructed a phylogenetic tree (such as figure 1 shown). Then, we took the tender stem parts of lowland switchgrass Alamo, extracted the total RNA from the tender stems with TriZol Reagent (Invitrogen, Cat. No. 15596026), and detected the content and purity of the total RNA by using agarose gel electrophoresis and a nucleic acid analyzer (NanoDrop). Take 2.0 μg of total RNA for reverse transcription reaction, the reverse transcriptase used is M-MLV (Promega Company, product number M1701), and the steps of reverse transcription reaction refer to...

Embodiment 2

[0028] Example 2: PvSAMS1 Gene interference silencing expression vector construction and genetic transformation

[0029] The interference silencing expression vector used in the present invention is pANIC8B. Clone by PCR reaction PvSAMS1 Interference fragment (SEQ ID NO.3), using primers:

[0030]F2: 5’TGGACCTCATGGTGATGCTGG3’ R2: 5’GCAGAAGGCTTCTCCCACTTG3’

[0031] Connect the target fragment to the modified entry vector pENTR by homologous recombination in fusion, and extract the recombinant strain plasmid with correct sequencing by alkaline lysis. Eco R V endonuclease 37 o C digestion for 1 h, and finally the target fragment was recombined into the pANIC8B vector by Gateway technology ( figure 2 ). The recombination reaction is: 100 ng of fragments recovered by digestion, 50 ng of pANIC8B vector plasmid, 1 μL of LR enzyme (Invitrogen, Cat. No. 11791020), and then use ddH 2 O to make up to 10 μL. 16 o C was attached overnight. Take 5 μL of the ligation product, t...

Embodiment 3

[0033] Example 3: Molecular Identification of Transgenic Plants

[0034] Take the tender stem tissue of the positive transgenic plants identified above, use the TriZol (Invitrogen Company, product number 15596026) method to extract total RNA, reverse transcriptase (Promega Company, product number M1701) to synthesize the first-strand cDNA, and switchgrass Ubiquitin Genes were used as internal reference genes, respectively using primers PvSAMS1 -F3 / R3 detected positive transgenic plants PvSAMS1 Gene expression ( Figure 4 ), the primer sequences are as follows:

[0035] wxya -F: 5’-TTCGTGGTGGCCAGTAAG-3’

[0036] wxya -R: 5’-AGAGACCAGAAGACCCAGGTACAG-3’

[0037] PvSAMS1 -F3: 5’-CTTGATATACCCCTTGCTTTCATTTG-3’

[0038] PvSAMS1 -R3: 5- TTCTTTCTTTCGTTGACCATTACAT-3’

[0039] Such as image 3 As shown, the endogenous PvSAMS1 Compared with the wild-type control, the expression level was significantly decreased, indicating that the exogenous PvSAMS1 Interference frag...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses application of a panicum virgatum L. S-adenosylmethionine synthase gene SAMS1 to change of the lignin content and further improvement on the saccharification efficiency, and belongs to the technical field of plant genetic engineering. The application comprises the following main contents: performing cloning and sequence determination on the panicum virgatum L. SAMS1 gene; constructing an interference expression vector (pANIC8B-PvSAMS1-RNAi) of the PvSAMS1 gene; transforming a panicum virgatum L. callus by an agrobacterium mediated method, and transforming an interference fragment of a target gene into lowland-type Alamo wild-type panicum virgatum L. to obtain a transgenic plant with reduced total lignin content. The expression quantity of the PvSAMS1 in the obtainedtransgenic plant is significantly reduced, the lignin content is significantly reduced, and the saccharification efficiency is significantly improved. Through regulation and control of lignin metabolism by the identified panicum virgatum L. SAMS1, a novel target can be provided for molecular breeding in future.

Description

technical field [0001] The invention belongs to the technical field of plant genetic engineering, in particular to switchgrass SAMS1 Modification of expression levels, changes in lignin content, and improved saccharification efficiency in switchgrass. Background technique [0002] switchgrass ( Panicum virgatum L.) belongs to the Poaceae Panicum genus and is a perennial C4 herb. It is a second-generation model energy plant and an important pasture resource. Plant cell walls are mainly composed of lignin, cellulose and hemicellulose, which are important factors in determining the efficiency of biomass energy conversion and the quality of pasture. As a biomass energy source, switchgrass has important practical guiding significance to analyze the regulatory mechanism related to its lignin metabolism pathway and improve the saccharification efficiency. [0003] In the synthetic pathway of lignin, the methylation process of its monomer is catalyzed by caffeoyl-CoA oxymethyl...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/54C12N9/10C12N15/82A01H5/00A01H6/46
CPCC12N9/1085C12N15/8218C12N15/8246C12N15/8255C12Y205/01006
Inventor 付春祥熊王丹吴振映刘雨辰齐天雄刘文文刘金丽
Owner QINGDAO INST OF BIOENERGY & BIOPROCESS TECH CHINESE ACADEMY OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap