Application of panicum virgatum L. S-adenosylmethionine synthase gene SAMS1 to regulation and control of lignin synthesis
A switchgrass and gene technology is applied in the field of transformation of switchgrass SAMS1 expression level to achieve the effect of increasing saccharification efficiency
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0023] Example 1: PvSAMS1 Gene cloning and sequencing
[0024] First, we base our research on rice SAMS research background (Li et al., Knockdown of SAMSgenes encoding S-adenosyl -L-methionine synthetases causes methylation alterations of DNAs and histones and leads to late flowering in rice. 2011, JPlant Physiol, 168: 1837-1843), searched the switchgrass database for the whole genome, obtained switchgrass SAMS candidate genes, and constructed a phylogenetic tree (such as figure 1 shown). Then, we took the tender stem parts of lowland switchgrass Alamo, extracted the total RNA from the tender stems with TriZol Reagent (Invitrogen, Cat. No. 15596026), and detected the content and purity of the total RNA by using agarose gel electrophoresis and a nucleic acid analyzer (NanoDrop). Take 2.0 μg of total RNA for reverse transcription reaction, the reverse transcriptase used is M-MLV (Promega Company, product number M1701), and the steps of reverse transcription reaction refer to...
Embodiment 2
[0028] Example 2: PvSAMS1 Gene interference silencing expression vector construction and genetic transformation
[0029] The interference silencing expression vector used in the present invention is pANIC8B. Clone by PCR reaction PvSAMS1 Interference fragment (SEQ ID NO.3), using primers:
[0030]F2: 5’TGGACCTCATGGTGATGCTGG3’ R2: 5’GCAGAAGGCTTCTCCCACTTG3’
[0031] Connect the target fragment to the modified entry vector pENTR by homologous recombination in fusion, and extract the recombinant strain plasmid with correct sequencing by alkaline lysis. Eco R V endonuclease 37 o C digestion for 1 h, and finally the target fragment was recombined into the pANIC8B vector by Gateway technology ( figure 2 ). The recombination reaction is: 100 ng of fragments recovered by digestion, 50 ng of pANIC8B vector plasmid, 1 μL of LR enzyme (Invitrogen, Cat. No. 11791020), and then use ddH 2 O to make up to 10 μL. 16 o C was attached overnight. Take 5 μL of the ligation product, t...
Embodiment 3
[0033] Example 3: Molecular Identification of Transgenic Plants
[0034] Take the tender stem tissue of the positive transgenic plants identified above, use the TriZol (Invitrogen Company, product number 15596026) method to extract total RNA, reverse transcriptase (Promega Company, product number M1701) to synthesize the first-strand cDNA, and switchgrass Ubiquitin Genes were used as internal reference genes, respectively using primers PvSAMS1 -F3 / R3 detected positive transgenic plants PvSAMS1 Gene expression ( Figure 4 ), the primer sequences are as follows:
[0035] wxya -F: 5’-TTCGTGGTGGCCAGTAAG-3’
[0036] wxya -R: 5’-AGAGACCAGAAGACCCAGGTACAG-3’
[0037] PvSAMS1 -F3: 5’-CTTGATATACCCCTTGCTTTCATTTG-3’
[0038] PvSAMS1 -R3: 5- TTCTTTCTTTCGTTGACCATTACAT-3’
[0039] Such as image 3 As shown, the endogenous PvSAMS1 Compared with the wild-type control, the expression level was significantly decreased, indicating that the exogenous PvSAMS1 Interference frag...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com