Unlock instant, AI-driven research and patent intelligence for your innovation.

Recombinant virus silencing T1 protein, and construction method and application thereof

A technology of recombinant virus and construction method, which is applied in the field of biomedicine, can solve the problems that affect the treatment effect of TrkB atherosclerosis, it is not easy to obtain high titer virus, and the expression level is low, so as to protect the integrity of the endothelial barrier and inhibit plaque The area of ​​the plaque, the lipid and macrophage content in the plaque, and the effect of promoting expression

Inactive Publication Date: 2018-07-10
SHANDONG UNIV QILU HOSPITAL
View PDF5 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, our previous research found that when using the virus expressing the full length of TrkB for the treatment of atherosclerosis: due to the long translation region of TrkB, it is not easy to obtain high-titer virus after it is introduced into the virus vector, and the expression level in vivo Low, seriously affecting the therapeutic effect of TrkB for the treatment of atherosclerosis

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant virus silencing T1 protein, and construction method and application thereof
  • Recombinant virus silencing T1 protein, and construction method and application thereof
  • Recombinant virus silencing T1 protein, and construction method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] Example 1: Construction of a recombinant virus for silencing T1 protein

[0040] 1. Design and synthesize the shRNA sequence based on the mouse T1 mRNA (NM_008745), and introduce a BamHI restriction site at the 5' end and a HindⅢ restriction site at the 3' end. The sequence is as follows:

[0041] mT1-shRNA-F (SEQ ID NO.1, the underline is the HindⅢ restriction site):

[0042] 5'-GATCCGCAGTTTCTCTAGTGTGAATAGTTCAAGAGACTATTCACACTAGAGAACTGCTTTTTTAGATCTA-3',

[0043] mT1-shRNA-R (SEQ ID NO.2, the underline is the BamHI restriction site):

[0044] 5'- AGCTT AGATCTAAAAAAGCAGTTTCTAGTGTGAATAGTCTCTTGAACTATTCACACTAGAGAACTGCG-3';

[0045] 2. Fully dissolve the mT1-shRNA-F and mT1-shRNA-R fragments in step 1 in 100 μL annealing buffer respectively, take 5 μL of each solution and add them to 5 μL 10× annealing buffer, add sterilized water to 50 μL, Mix well, anneal at 100°C for 2 minutes, cool naturally to room temperature, and dilute 100 times with sterile water to obtain the m...

Embodiment 2

[0058] Example 2: Verification of in vivo infection efficiency and silencing efficiency of recombinant virus

[0059] Sixty 8-week-old C57BL / 6 mice were selected and divided into two groups. The control group was injected with a recombinant virus containing scrambled shRNA (rAAV9-ZsGreen-ShRNA-mScramble) through the tail vein of the mice, and the experimental group was injected with The recombinant virus for silencing the T1 protein constructed in Example 1 was injected through the mouse tail vein with a disposable syringe, and the injection dose was 7×10 10 vg / g body weight and 20 μL / g body weight, fed with normal diet for 16 weeks;

[0060] Preparation of cryosections from mouse aorta

[0061] Immunofluorescence staining, observing the expression of reporter gene ZsGreen, verifying the infection efficiency; detecting the expression of T1 protein, verifying the silencing efficiency: frozen sections of aortic root were fixed with 4% paraformaldehyde, soaked in PBS, blocked wi...

Embodiment 3

[0063] Example 3: Application of recombinant virus in improving endothelial function in mice with atherosclerosis

[0064] To establish an animal model of endothelial injury: select 60 8-week-old ApoE knockout mice, divide them into 2 groups, and feed them normally for 16 weeks;

[0065] At the beginning of modeling, the mice were simultaneously injected with the recombinant virus through the tail vein of the mouse with a disposable syringe, the control group was injected with the recombinant virus containing scrambled shRNA (rAAV9-ZsGreen-ShRNA-mScramble), and the experimental group was injected with the recombinant virus constructed in Example 1. Recombinant virus for silencing T1 protein, the injection dose is 7×10 1 0vg / g body weight and 20μL / g body weight;

[0066] After 16 weeks of normal feeding, Evans blue was dissolved in 0.2ml PBS according to the dose of 20mg / kg body weight, injected through the tail vein of the mouse, and anesthetized by intraperitoneal injection ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a recombinant virus silencing a T1 protein, and a construction method and an application thereof, and belongs to the technical field of biomedicine. Firstly, a shRNA silencingthe T1 protein is designed and synthesized and then is introduced into a viral vector, and then the viral vector is packed to prepare the recombinant virus silencing the T1 protein. The recombinant virus can highly efficiently infect aorta endothelium in mouse bodies, is expressed in aortic endothelial cells for a long time, can protect integrity of endothelial barrier of atherosclerotic model mice, promotes the expression of endothelial cadherin, and significantly inhibits the development of atherosclerosis. The recombinant virus silencing the T1 protein is expected to become a genetic drugfor treatment of atherosclerosis related diseases.

Description

technical field [0001] The invention relates to a recombinant virus for silencing T1 protein and its construction method and application, belonging to the technical field of biomedicine. Background technique [0002] Cardiovascular disease is the second killer after malignant tumors and one of the leading causes of death. Cardiovascular disease mainly refers to coronary heart disease, that is, coronary heart disease. Atherosclerosis is the main pathological basis of coronary heart disease. It is manifested by lipid deposition on the inner walls of large and medium arteries, forming scattered or sheets of atheromatous plaques, resulting in narrowing of the arterial lumen, and subsequent plaque rupture and bleeding. Thrombus forms in narrow arteries. If thrombus occurs in the brain or cerebral arteriosclerosis ruptures, it can cause brain ischemia and necrosis, which is stroke. Cardiovascular disease develops to late stage, because the heart pumps poorly for a long time, the...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N7/01A61K35/76A61K31/7105A61K48/00A61P9/10
CPCA61K31/7105A61K35/76C07K14/705C12N7/00C12N2750/14121
Inventor 姜虹刘彦
Owner SHANDONG UNIV QILU HOSPITAL