A kind of method of highly efficient full degradation polycaprolactone

A polycaprolactone, full-degradation technology, applied in the field of fusion enzyme application, can solve the problems of pollution, slow degradation of polycaprolactone waste, etc.

Active Publication Date: 2021-07-20
NANJING FORESTRY UNIV
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Purpose of the invention: Aiming at the problems of slow degradation and pollution of polycaprolactone waste in nature, the purpose of the present invention is to provide a method for fully degrading polycaprolactone with high efficiency, that is, to provide an engineered polycaprolactone by using genetic engineering technology High-efficiency bifunctional degrading enzyme for PCL degradation technology, the bifunctional enzymatic degradation technology has high degradation efficiency, complete degradation, and recyclable degradation products, which are expected to be used in the degradation and natural regeneration of industrialized PCL

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of method of highly efficient full degradation polycaprolactone
  • A kind of method of highly efficient full degradation polycaprolactone
  • A kind of method of highly efficient full degradation polycaprolactone

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] The cloning of embodiment 1 gene

[0037] Using the Lip gene sequence (from T.lanuginosus, the nucleotide sequence shown in SEQ ID NO.3) as a template, using primer 5'-AGAGAGGCTGAAGCTGAATTCCGGCCTGTTCGACGAGCGGT-3' and primer 5'-AGGTGGGGTTGGGTGCGCTGCTGGTTGTCGTAGGTCCATCACTCTGAAAT-3' to perform PCR amplification to obtain the fusion The Lip fragment of the enzyme Lip-Cut; using the Cut gene sequence (from T.Terrestris, the nucleotide sequence shown in SEQ ID NO.4) as a template, using primer 5'-ACCCAACCCCACCTCCAGTGGCTGCCCGAATGCCACCAAGGCCCCAACACAGCCA-3' and primer 5'-GAGATGAGTTTTTGTTCTAGAAATCAATGATGATGATGATGATGAGCATCACCAATCTT- Perform PCR amplification at 3' to obtain the Cut fragment containing the linker of the fusion enzyme Lip-Cut; use the Lip fragment and the Cut fragment of the bifunctional fusion enzyme Lip-Cut as templates, use primer 5'-AGAGAGGCTGAAGCTGAATTCCGGCCTGTTCGACGAGCGGT-3' and primer 5'- GAGATGAGTTTTTGTTCTAGAAATCAATGATGATGATGATGATGAGCATCACCAATCTT-3' was ampl...

Embodiment 2

[0039] Embodiment 2 Lip, the expression and purification of Cut and Lip-Cut in P.pastoris KM71H

[0040] The positive clone DH5α with correct sequencing was inoculated into a test tube containing 3 mL of LB liquid medium, and cultured at 37°C with shaking at 200 rpm / min for about 12 hours. The mini-extraction of recombinant expression plasmids pPICZαA-Lip, pPICZαA-Cut and pPICZαA-Lip-Cut was extracted using EasyPure Plasmid MiniPrepKit of Beijing Quanshijin Biotechnology Co., Ltd. Transfer the extracted recombinant expression plasmids pPICZαA-Lip, pPICZαA-Cut and pPICZαA-Lip-Cut into P. pastoris KM71H, coat a plate containing 100 μg / mL Zeocin to screen positive clones, and insert the screened positive clones into Cultivate 100μg / mL Zeocin in 3mL YPD liquid medium on a shaker for 16-18h; inoculate the cultured bacteria solution into 50mL sterilized BMGY medium at a ratio of 1:100-1:50, at 28°C, 200rpm / min Shake culture to OD 600 =6.0-8.0; Centrifuge the bacterial solution at ...

Embodiment 3

[0042] Using the bifunctional fusion enzyme Lip-Cut to degrade PCL, the steps are:

[0043] 1) Weigh 1g of polycaprolactone (PCL) and dissolve it in 100mL of chloroform, and use a magnetic stirrer RH-KT / C to stir the various polyesters evenly for about 12 hours;

[0044] 2) Put the various solutions that are completely dissolved into polytetrafluoroethylene containers and evaporate naturally for later use;

[0045] 3) Peel off the prepared various polymer films from the container, and cut it into about 5×10mm 2 samples, and then dried in a constant temperature drying oven, preserved and set aside;

[0046] 4) Add 1mL pH8.00.05M phosphate buffer (K 2 HPO 4 -KH 2 PO 4 ), various polymer films after accurate weighing, Lip, Cut and Lip-Cut with the same number of molecules (0.869nmol), at the optimum temperature (35℃Lip, 40℃Lip-Cut, 40℃ , 50°C Cut) and 150rpm / min for 48 hours of hydrolysis respectively. During the experiment, samples were taken regularly, and the control gro...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for fully degrading polycaprolactone with high efficiency. In the degradation of polycaprolactone, a bifunctional fusion enzyme is used for degradation. The bifunctional fusion enzyme is a bifunctional fusion containing lipase and cutinase activities. Enzyme Lip-Cut, the amino acid sequence of which is shown in SEQ ID NO.1. In the method of the present invention, the bifunctional enzyme used is obtained by engineering and construction based on the complementarity of cutinase and lipase in the hydrolysis mechanism, and can synergistically exert the catalytic performance of the two enzymes under mild conditions, and rapidly degrade the complete PCL to 6 ‑Hydroxycaproic acid monomer is easy to recycle and reuse, and has good application prospects in PCL degradation and resource regeneration.

Description

technical field [0001] The invention belongs to the technical field of fusion enzyme applications, and in particular relates to a method for efficiently and thoroughly degrading polycaprolactone (PCL) by using the bifunctional fusion enzyme Lip-Cut. Background technique [0002] Synthetic polyester is a kind of polymer material with a wide range of applications and huge consumption. While the synthetic polyester industry is developing rapidly and widely used, a large amount of polyester waste will be produced every year. Although these wastes are not very toxic and will not directly harm the environment and human beings, due to their large number and difficulty in degrading under natural conditions, these wastes have become global environmental polluting organic substances. Polycaprolactone (PCL) is widely used as medical modeling materials, industry, art modeling materials, toys, organic colorants, hot-copy ink adhesives, hot-melt adhesives, etc. Although polycaprolactone ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N9/20C12N9/18C12N15/81A62D3/02C12R1/84A62D101/28
CPCA62D3/02A62D2101/28C07K2319/00C12N9/18C12N9/20C12N15/62C12N15/815C12Y301/01003C12Y301/01074
Inventor丁少军刘敏
OwnerNANJING FORESTRY UNIV