Transaminase mutant as well as application thereof to preparation of sitagliptin midbody

A technology of mutants and transaminases, applied in the field of recombinant genetically engineered bacteria and recombinant enzymes to prepare optically pure sitagliptin intermediates, can solve the problems of high conversion rate of raw materials, low production cost, high yield, etc., and achieve stereoselectivity high effect

Active Publication Date: 2018-11-23
ZHEJIANG UNIV OF TECH +2
View PDF19 Cites 14 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0015] The present invention aims at the defects (poor stereoselectivity, expensive catalyst, difficult recovery of solvent, etc.) existing in the existing production process of sitagliptin intermediate, and provides a transaminase mutant, coding gene, recombinant carrier, recombinant Genetically engineered bacteria, and an enzymatic asymmetric transamination to obtain sitagliptin (or sitagliptin esters) intermediate, the method has high raw material conversion rate, low production cost and high yield

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Transaminase mutant as well as application thereof to preparation of sitagliptin midbody
  • Transaminase mutant as well as application thereof to preparation of sitagliptin midbody
  • Transaminase mutant as well as application thereof to preparation of sitagliptin midbody

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0046] Embodiment 1: the amplification of transaminase gene MgTA

[0047] According to the sequencing information of the transaminase gene from Arthrobacter nitroguajacolicus included in Genbank, the ω-transaminase of Arthrobacter nitroguajacolicus ZJUTB06-99 (disclosed in the patent, application number CN201110224295.7) was extracted with a rapid nucleic acid extraction instrument The total genomic DNA, using the genomic DNA as a template, is subjected to PCR amplification under the action of primer 1 (ATGGGTATCGACACCGGTACCTC) and primer 2 (GTACTGGATAGCTTCGATCAGCG). PCR reaction system (total volume 50 μL): 5 μL of 10×Pfu DNA Polymerase Buffer, 1 μL of 10 mM dNTP mixture (2.5 mM each of dATP, dCTP, dGTP, and dTTP), 1 μL of cloning primer 1 and primer 2 each at a concentration of 50 μM, genomic DNA 1 μL, Pfu DNAPolymerase 1 μL, nucleic acid-free water 40 μL.

[0048] Using BioRad PCR instrument, PCR reaction conditions: pre-denaturation at 95°C for 5min, denaturation at 95°C ...

Embodiment 2

[0050] Embodiment 2: Construction of recombinant Escherichia coli BL21 / pET28b-MgTA

[0051]According to the MgTA gene sequence design primer 3 (CCG CATATG GGTATCGACACCGGTACCTC), primer 4 (TTG CTCGAG GTACTGGATAGCTTCGATCAGC), and Nde I and Xho I restriction enzyme sites (underlined) were introduced into primer 3 and primer 4, respectively. Under the triggering of primer 3 and primer 4, the high-fidelity Pfu DNA polymerase was used to amplify, and the recombinant plasmid pMD18-T-MgTA was used as a template (obtained in Example 1) to obtain the MgTA gene sequence, which was sequenced using NdeI and Xho The amplified fragment was treated with I restriction endonuclease (TaKaRa), and the fragment was ligated with the commercial vector pET28b (Invitrogen) treated with the same restriction endonuclease using T4 DNA ligase (TaKaRa) to construct an expression Vector pET28b-MgTA ( Figure 8 ). The constructed expression vector pET28b-MgTA was transformed into Escherichia coli BL21(...

Embodiment 3

[0052] Example 3: Induced expression of transaminase (ω-MgTA)

[0053] The recombinant Escherichia coli BL21(DE3) / pET28b-MgTA obtained in Example 2 was inoculated into LB liquid medium containing 50 μg / ml kanamycin resistance, cultivated at 37° C. for 12 hours at 200 rpm, and then treated with 1% (v / v) The inoculum is inoculated into fresh LB liquid medium containing 50 μg / ml kanamycin resistance, cultivated at 37°C and 150 rpm until the OD of the bacteria 600 After reaching 0.6-0.8, add IPTG with a final concentration of 0.1mM, induce culture at 28°C for 12h, centrifuge at 5000rpm at 4°C for 25min, discard the supernatant, collect the precipitate, and obtain recombinant Escherichia coli BL21 / pET28b-MgTA wet cells. The bacterium can be used directly as a biocatalyst or for protein purification.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a transaminase mutant as well as application thereof to preparation of sitagliptin midbody. The application adopts a wet thallus obtained by fermenting and culturing recombinant escherichia coli comprising aminotransferase coded gene as a biological catalyst, adopts sitagliptin midbody precursor ketone as a substrate, adopts dimethyl sulfoxide as a co-solvent and , adopts phosphopyridoxal as co-enzyme, adopts isopropylamine as an auxiliary substrate, adopts a pH 8-9 triethanolamine buffering solution as a reaction medium to form a reaction system to perform the biological catalytic reaction under the conditions that the temperature is 30 to 45 DEG C, and the stirring rate is 100 to 250 r / min, after the reaction is ended, the reaction solution is separated and purified to obtain sitagliptin; and the total yield of the method is about 81 percent, and a e.e. value of the product reaches 99 percent.

Description

(1) Technical field [0001] The present invention relates to the field of biochemical technology, specifically, a method for preparing an optically pure sitagliptin intermediate of ω-transaminase and its mutant enzyme, including transaminase, mutant, coding gene, and recombinant vector containing the gene , the recombinant genetically engineered bacteria and recombinant enzyme transformed with the recombinant vector, and applications. (2) Background technology [0002] Sitagliptin is the first dipeptidyl peptidase-IV (DPP-IV) inhibitor approved by the FDA for the treatment of type 2 diabetes (October 2016). moon). DPP-IV is a multifunctional enzyme that exists on the cell membrane in the form of a homodimer, which can cleave a variety of peptide hormones including glucagon-like peptide-1 and gastric inhibitory peptide, which are related to Type 2 diabetes is closely related. DPP-IV inhibitors reduce the degradation of GLP-1 by inhibiting DPP-IV and increase the plasma conc...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/10C12P13/00
CPCC12N9/1096C12P13/001C12Y206/01
Inventor郑裕国程峰柳志强何人宝金逸中汤晓玲邵鸿鸣张晓健周国斌林娇华张峰杨海龙
OwnerZHEJIANG UNIV OF TECH