Cotton calcium-dependent protein kinase GhCPK33 gene for regulating verticillium wilt resistance of cotton, and applications thereof
A cotton verticillium wilt, protein kinase technology, applied in the fields of application, genetic engineering, plant gene improvement, etc., can solve the problems of unsatisfactory effect, difficult polymerization, high cost of biological control, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0038] Embodiment 1: Isolation and cloning of GhCPK33 gene
[0039] 1. Gene sequence acquisition
[0040] The applicant's previous work was based on the analysis of the expression profile data of upland cotton YZ1 (variety from the Cotton Research Institute of the Chinese Academy of Agricultural Sciences) inoculated with Verticillium dahliae V991, combined with the VIGS method, a gene that negatively regulates cotton Verticillium wilt resistance was identified . Sequence alignment was carried out in the NCBI database, and it was found that this gene had high homology with the GhCPK33 gene in Asian cotton (Gossypium arboretum) and Raymond's cotton (Gossypium raimondii), so the isolated gene was named GhCPK33 gene (see figure 1 ).
[0041] Using primers GhCPK33-full-F (5'ATGGGTTCTTGCCTGACGAAAAGC3') and GhCPK33-full-R (5'CTAAAAGAGTTGTGTGTGTTGGG3'), the full-length sequence of GhCPK33 was cloned using the cDNA of upland cotton YZ1 as a template. The PCR reaction conditions were...
Embodiment 2
[0046] Example 2: Gene Silencing Using the VIGS Method
[0047] 1. Seedling cultivation in greenhouse
[0048] The seeds of the cotton line YZ1 with full grains were selected, soaked in warm water at 25°C for 2 hours, then spread flat on the soaked gauze, covered with a layer of moist gauze, and placed in an incubator at 28°C to accelerate germination. When the seed root grows to 1-2cm, it can be transplanted into nutrient soil (volume ratio, nutrient soil: vermiculite=3:1) for planting. Gently put the young roots of the seeds into the nutrient soil, cover it with 1-2cm thick nutrient soil, then cover it with plastic wrap, and cultivate it under light, set the temperature at 28°C, and light for 16 hours. After the seedlings break through the soil, Peel off the film. Injection can be performed when the cotyledons of the seedlings are fully expanded.
[0049] 2. Activation and preservation of Agrobacterium
[0050] 2.1 Preparation:
[0051] The Agrobacterium strain is GV310...
Embodiment 5
[0075] Example 5: Identification of Botrytis cinerea inoculation on transgenic material
[0076] 1. Activation and cultivation of Botrytis cinerea
[0077] Take a piece about 1cm 2 Botrytis cinerea (strain number BC17, gifted by Professor Li Guoqing of Huazhong Agricultural University, is a conventional gray mold strain, and the use of special strains is not particularly emphasized in this test), inoculated on a new PDA plate, and cultured in the dark at 25°C for about 5 days , when the mycelium covers the whole culture dish, it can be inoculated for treatment.
[0078] 2. Botrytis cinerea inoculation
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 



