Cotton calcium-dependent protein kinase GhCPK33 gene for regulating verticillium wilt resistance of cotton, and applications thereof

A cotton verticillium wilt, protein kinase technology, applied in the fields of application, genetic engineering, plant gene improvement, etc., can solve the problems of unsatisfactory effect, difficult polymerization, high cost of biological control, etc.

Inactive Publication Date: 2019-01-01
HUAZHONG AGRI UNIV
View PDF2 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Cotton verticillium wilt is a soil-borne vascular disease caused by Verticillium dahliae. At present, there is no specific and specific chemical agent, and the cost of biological control is high, and the effect is not ideal. Therefore, breeding of disease-resistant varieties It is the main way to prevent and control the disease (Wang Shengzheng et al., Study on genetic characteristics of cotton planting KV-3 resistance in new lines resistant to Verticillium wilt. Acta Cotton Sinica, 2010, 22(5):501~504)
Studies have shown that the resistance of upland cotton to Verticillium wilt is basically susceptible or resistant, and most of the disease-resistant loci carried by it are micro-effect polygenic loci, which are greatly affected by the environment and difficult to aggregate. No varieties with high resistance to Verticillium wilt of cotton have been widely applied

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Cotton calcium-dependent protein kinase GhCPK33 gene for regulating verticillium wilt resistance of cotton, and applications thereof
  • Cotton calcium-dependent protein kinase GhCPK33 gene for regulating verticillium wilt resistance of cotton, and applications thereof
  • Cotton calcium-dependent protein kinase GhCPK33 gene for regulating verticillium wilt resistance of cotton, and applications thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] Embodiment 1: Isolation and cloning of GhCPK33 gene

[0039] 1. Gene sequence acquisition

[0040] The applicant's previous work was based on the analysis of the expression profile data of upland cotton YZ1 (variety from the Cotton Research Institute of the Chinese Academy of Agricultural Sciences) inoculated with Verticillium dahliae V991, combined with the VIGS method, a gene that negatively regulates cotton Verticillium wilt resistance was identified . Sequence alignment was carried out in the NCBI database, and it was found that this gene had high homology with the GhCPK33 gene in Asian cotton (Gossypium arboretum) and Raymond's cotton (Gossypium raimondii), so the isolated gene was named GhCPK33 gene (see figure 1 ).

[0041] Using primers GhCPK33-full-F (5'ATGGGTTCTTGCCTGACGAAAAGC3') and GhCPK33-full-R (5'CTAAAAGAGTTGTGTGTGTTGGG3'), the full-length sequence of GhCPK33 was cloned using the cDNA of upland cotton YZ1 as a template. The PCR reaction conditions were...

Embodiment 2

[0046] Example 2: Gene Silencing Using the VIGS Method

[0047] 1. Seedling cultivation in greenhouse

[0048] The seeds of the cotton line YZ1 with full grains were selected, soaked in warm water at 25°C for 2 hours, then spread flat on the soaked gauze, covered with a layer of moist gauze, and placed in an incubator at 28°C to accelerate germination. When the seed root grows to 1-2cm, it can be transplanted into nutrient soil (volume ratio, nutrient soil: vermiculite=3:1) for planting. Gently put the young roots of the seeds into the nutrient soil, cover it with 1-2cm thick nutrient soil, then cover it with plastic wrap, and cultivate it under light, set the temperature at 28°C, and light for 16 hours. After the seedlings break through the soil, Peel off the film. Injection can be performed when the cotyledons of the seedlings are fully expanded.

[0049] 2. Activation and preservation of Agrobacterium

[0050] 2.1 Preparation:

[0051] The Agrobacterium strain is GV310...

Embodiment 5

[0075] Example 5: Identification of Botrytis cinerea inoculation on transgenic material

[0076] 1. Activation and cultivation of Botrytis cinerea

[0077] Take a piece about 1cm 2 Botrytis cinerea (strain number BC17, gifted by Professor Li Guoqing of Huazhong Agricultural University, is a conventional gray mold strain, and the use of special strains is not particularly emphasized in this test), inoculated on a new PDA plate, and cultured in the dark at 25°C for about 5 days , when the mycelium covers the whole culture dish, it can be inoculated for treatment.

[0078] 2. Botrytis cinerea inoculation

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of plant genetic engineering, and particularly relates to a cotton calcium-dependent protein kinase GhCPK33 gene for regulating the verticillium wilt resistance of cotton, and applications thereof. According to the present invention, the calcium ion-dependent protein kinase GhCPK33 gene with the characteristic of verticillium wilt induced expression isscreened by inoculating Verticillium dahliae in Gossypium hirsutum Linn and analyzing RAN-Seq data at different time points, wherein the nucleotide sequence of the gene is represented by SEQ ID NO:1,and the protein sequence encoded by the gene is represented by SEQ ID NO:2. According to the present invention, through the VIGS system, the corresponding gene in cotton is silenced, Verticillium dahliae is inoculated, and the function of the gene in the verticillium wilt resistance of cotton is quickly identified; and the isolated gene provides the negative regulation effect in the verticillium wilt resistance of cotton, and by silencing the gene, the verticillium wilt resistance of cotton can be significantly improved.

Description

technical field [0001] The invention belongs to the field of plant genetic engineering, and in particular relates to a cotton calcium-dependent protein kinase GhCPK33 gene for regulating cotton Verticillium wilt resistance and its application. Background technique [0002] Cotton is an important economic crop in my country, and Verticillium dahliae is known as the "cancer" of cotton, which seriously endangers the yield and fiber quality of cotton. In recent years, Verticillium wilt has occurred year after year, causing a 10-20% reduction in my country's cotton production year-round, and up to 70% in some areas when the disease is severe. It has become one of the main obstacles restricting my country's high and stable cotton production. Cotton verticillium wilt is a soil-borne vascular disease caused by Verticillium dahliae. At present, there is no specific and specific chemical agent, and the cost of biological control is high, and the effect is not ideal. Therefore, breedin...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/54C12N9/12C12N15/82
CPCC12N9/12C12N15/8282C12Y207/11017
Inventor张献龙朱龙付胡琴李南南
OwnerHUAZHONG AGRI UNIV