Carthamus tinctorius CYP75A1 gene and application thereof
A technology of CYP75A1F and safflower, applied in the field of bioengineering, can solve problems affecting the synthesis of secondary metabolites and signal transduction, and achieve the effect of reducing the content of flavonoids
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0021] Example 1 Extraction of RNA from safflower petals
[0022] safflower( Carthamus tinctorius L.) Petal RNA extraction, the extraction steps are as follows:
[0023] 1) Wrap the tweezers, mortar, pestle and medicine spoon with tinfoil, put them in a 180°C oven for 4 hours for dry heat sterilization, and set aside;
[0024] 2) Treat 1.5mL centrifuge tubes and pipette tips with 0.1% DEPC water overnight, then autoclave at 120°C for 20 minutes, and place them in an oven at 60°C to dry for later use;
[0025] 3) Take about 100 mg of safflower petals, add liquid nitrogen and quickly grind to fine powder, divide into two 1.5mLEP tubes, add 1mL RNAiso Plus to each, mix well, and let stand at room temperature for 5 minutes;
[0026] 4) Centrifuge at 12000rpm for 5min at 4°C, transfer the supernatant to a new 1.5mL centrifuge tube;
[0027] 5) Add 1 / 5 RNAiso Plus volume of chloroform, shake, mix, and let stand at room temperature for 5 minutes;
[0028] 6) Centrifuge at 12000rp...
Embodiment 2
[0035] Example 2 Synthesis of the first strand cDNA
[0036] The RNA stored at -80°C was taken, and the concentration of RNA was detected by nanogrop. The concentration of extracted RNA was about 1000 ng / ul; reverse transcription of cDNA was carried out according to the operation instructions of the reverse transcription kit. The reverse transcription reaction system is shown in Table 1. and Table 2, the reverse-transcribed cDNA was stored in a -20°C refrigerator for later use.
[0037]
[0038] The above reaction system was reacted on a PCR instrument: 65°C, 5min, and quickly cooled on ice.
[0039]
[0040] Reverse transcription reaction conditions, 42°C, 55min; 70°C, 10min; place on ice to cool, obtain cDNA for subsequent reactions, and freeze at -20°C for future use.
Embodiment 3
[0041] Example 3 Cloning of Safflower CYP75A 1 Gene Coding Region Sequence
[0042] According to the sequence of the coding region obtained from the sequencing results of the safflower genome, design specific primers:
[0043] CYP75A1R: ATGCTCATTCACTTTGGTAGTTT
[0044] CYP75A1F: TCACCGAGCACTTAACTTGAC;
[0045] Cloning of the coding region sequence; amplifying the coding region sequence using the safflower petal cDNA as a template to obtain the target gene fragment ( figure 2 A), the total PCR reaction system is 50 μL, in which:
[0046] cDNA 1 μL
[0047] dNTP Mixture 8μL
[0048] 10×LA Buffer 5μL
[0049] LA Taq 0.5 μL
[0050] ERF1f (10µM) 1µL
[0051] ERF1r (10 µM) 1 µL
[0052] h 2 O 33.5 μL;
[0053] The PCR reaction conditions were: 94°C for 10 min, 94°C for 30 s, 62°C for 30 s, 72°C for 90 s, 30 cycles; after gel recovery, it was connected to the cloning vector pEASY-T1 (Beijing Quanshijin Biotechnology Co., Ltd.), Further through bacterial liquid PCR ( fi...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More