A strain of Corynebacterium glutamicum overexpressing adenosine triphosphate and its construction method and application

A technology of adenosine triphosphate and Corynebacterium glutamicum, which is applied in the biological field, can solve the problems of weak film-forming ability and continuous fermentation, and achieve the effects of increased proline production, enhanced initial adhesion ability, and shortened fermentation cycle

Active Publication Date: 2020-05-08
NANJING TECH UNIV
View PDF5 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] The technical problem to be solved by the present invention is to provide a Corynebacterium glutamicum overexpressing ATPase to solve the problem in the prior art that Corynebacterium glutamicum has weak film-forming ability and cannot be used for continuous fermentation

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A strain of Corynebacterium glutamicum overexpressing adenosine triphosphate and its construction method and application
  • A strain of Corynebacterium glutamicum overexpressing adenosine triphosphate and its construction method and application
  • A strain of Corynebacterium glutamicum overexpressing adenosine triphosphate and its construction method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] Example 1: Construction of recombinant plasmids.

[0030] ATPase upper primer ATPase-F and lower primer ATPase-R were used to carry out conventional PCR with the genome of the original strain Corynebacterium glutamicum ATCC13032 as a template to obtain ATPase gene fragments, which were then purified.

[0031] ATPase-F: gcctgcaggtcgactctagaggatccatgactgacattgatctggtggtggaa (on the first 20 bp plasmid, the bold font is the BamHI restriction site);

[0032] ATPase-R: aattcgagctcggtacccggggatccctagggcataaaccatgcctcttcg (on the last 20 bp of the plasmid, the boldface is the BamHI restriction site).

[0033] One-step cloning of this fragment and the pXMJ19 plasmid digested by BamHI to obtain the recombinant plasmid pXMJ19 / *ATPase for overexpressing the ATPase gene. See the agarose gel electrophoresis diagram Image 6 .

Embodiment 2

[0035] The resulting pXMJ19 / *ATPase recombinant plasmid was introduced into the competent Corynebacterium glutamicum ATCC13032, screened on the LB plate containing 6.5ug / ml chloramphenicol, cultured for 2 to 3 days, and then picked out the transformant in the LB plate containing 6.5 ug / ml chloramphenicol in LB liquid medium, cultured at 30°C and 200rpm / min for 1-2 days, and then verified by colony PCR to obtain recombinant bacteria overexpressing adenosine triphosphatase ATPase. Validation primer 1: aattaagcttgcatgcctgcaggt, validation primer 2: atcggcgctacggcgtttca. After the successful construction of the transformed strain, 96-well plate and 6-well plate experiments, as well as FESEM and CLSM electron microscope experiments were carried out. Electron microscope photos can visually and concretely see the amount and shape of the biofilm. After the film-forming effect is improved, continuous fermentation is carried out.

[0036] figure 1 Among them, A and B are the original...

Embodiment 3

[0039] Embodiment 3: Fermentation experiment of recombinant bacteria proline.

[0040] The components per liter of the activation medium are as follows: glucose 10-20g, peptone 8-15g, yeast powder 5-12g, sodium chloride 8-15g.

[0041] The components per liter of the seed medium are as follows: 25-35g of glucose, 15-25g of corn steep liquor, 5-10g of ammonium sulfate, 0.1-1g of magnesium sulfate heptahydrate, 0.5-2g of potassium dihydrogen phosphate, and 1-5g of urea.

[0042] The composition per liter of the fermentation medium is as follows: 80-120g of glucose, 20-25g of corn steep liquor, 20-30g of ammonium sulfate, 0.1-1g of magnesium sulfate heptahydrate, 0.5-2g of potassium dihydrogen phosphate, and 1-5g of urea.

[0043]Add 5ml of activation medium to each 50ml centrifuge tube, connect the bacteria Corynebacterium glutamicum ATCC13032 and the recombinant bacteria respectively, and activate them at 28-34°C and 200-250rpm for 18h.

[0044] After the activation is complet...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a Corynebacterium glutamicum overexpressing adenosine triphosphatase, wherein the gene sequence of the adenosine triphosphatase is shown as SEQ ID NO: 1. As that adenosine triphosphatase ATPase is overexpress in Corynebacterium glutamicum, the invention provides energy for the intermediate convert protein VirB11, causes the pili to fall off to form a type IV secretion pathway, increases the amount of extracellular DNA secretion, improves the initial adhesion ability of the bacteria, and improves the stability of the biofilm structure.

Description

technical field [0001] The invention relates to a Corynebacterium glutamicum strain overexpressing adenosine triphosphate and its construction method and application, belonging to the field of biotechnology. Background technique [0002] Biofilm, also known as biofilm, is a form of survival for bacteria to grow and reproduce better in the environment. The formation of biofilm is divided into four stages: adsorption, value-added, maturation and dispersion, and the dispersed cells enter the first stage again and the previous cycle, in which the adsorption period is divided into reversible and irreversible stages. In the process of biofilm formation, cells secrete extracellular substances, the main components of which are proteins, polysaccharides, and eDNA. These chemical components aggregate into dense inclusion bodies, thereby promoting the formation of biofilms. Previous studies have shown that proteins act as pillars to support the spatial structure of biofilms, and polys...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N1/21C12N9/14C12N15/55C12N15/77C12P13/24C12R1/15
CPCC12N9/14C12N15/77C12P13/24C12Y306/01003
Inventor应汉杰任培芳陈勇刘娜奚迅孙文俊陈天鹏
OwnerNANJING TECH UNIV