Method for preparing laminaribiose

A technology of laminadisaccharide and identity, which is applied in the field of in vitro enzymatic preparation of laminadisaccharide, can solve the problem of high cost of separation, and achieve the effect of improving conversion efficiency and high utilization rate of raw materials

Active Publication Date: 2019-05-03
TIANJIN INST OF IND BIOTECH CHINESE ACADEMY OF SCI
View PDF2 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Japanese scientists use 3 enzymes (sucrose phosphorylase, glucose isomerase and laminaribiose phosphorylase) to produce laminaribiose with sucrose as a substrate. However, the yield of laminaribiose is only about 50%, which leads to subsequent Higher cost of product separation

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for preparing laminaribiose
  • Method for preparing laminaribiose
  • Method for preparing laminaribiose

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0049] Example 1 In vitro multi-enzyme catalyzed conversion of starch and glucose into laminaribiose

[0050] The catalytic pathway for the conversion of starch and glucose to laminaribiose by a multi-enzyme catalytic system in vitro see figure 1 . The key enzymes involved include: (1) starch phosphorylase (αGP, EC 2.4.1.1), which is used to release glucose-1-phosphate from starch; (2) laminaribiose phosphorylase (LBP, EC 2.4 .1.31), used to catalyze the formation of laminaribiose from glucose-1-phosphate and glucose.

[0051] In this example, starch phosphorylase is derived from Thermotoga maritima, and its gene number on KEGG is TM1168; laminaribiose phosphorylase is derived from Paenibacillus sp., and its gene is in The number on KEGG is BAJ10826, and these genomic DNAs can be obtained from the official website of ATCC (www.atcc.org). 这两个基因分别用F1 / R1和F2 / R2从相应的基因组DNA中通过PCR获取,其中,F1:GTTTAACTTTAAGA AGGAGATATAGTGCTGGAGAAACTTCCCGAG,R1:GTGGTGGTGGTGGTGCTCGAGTCAGAGAACCTTCTTCCAGAC,F2...

Embodiment 2

[0055] Example 2 Improve the yield of laminaribiose by adding enzymes that promote starch hydrolysis

[0056] Starch phosphorylase cannot completely hydrolyze starch, and adding isoamylase (IA, EC 3.2.1.68) which can help hydrolyze starch in the reaction system can increase the yield of laminaribiose.

[0057] In this example, the isoamylase is derived from Sulfolobus tokodaii, whose gene number on KEGG is ST0928, and the genomic DNA of this strain is purchased from DSMZ, the German Culture Collection. This gene was obtained from the corresponding genomic DNA by PCR with primers F3 / F4, wherein, F3: GTTTAACTTTAAGAAGGAGATATAATGGTTTTTTCACAAGGATAGA CC, R: GTGGTGGTGGTGGTGGTGCTCGAGCTAATATTCAATCCTCCTATAT ACC, and cloned into pET20b vector by Simple Cloning method to obtain the corresponding expression vector pET20b-StIA. Then, this plasmid is transformed into Escherichia coli expression strain BL21 (DE3), carries out protein expression and purification, and the result of protein purifi...

Embodiment 3

[0062] Example 3 By optimizing the reaction conditions, the yield of laminaribiose was further improved

[0063] The preparation of isoamylase, starch phosphorylase and laminaribiose phosphorylase is the same as in Example 1 and Example 2.

[0064] Contain 5mM sodium acetate buffer solution (pH 5.5), 0.5mM divalent magnesium ion, 1U isoamylase, 10mg starch in a 1.0mL reaction system, carry out catalytic reaction at 85 ℃, reaction time is 12 hours.

[0065] Then in a 1.0mL reaction system containing 100mM HEPES buffer (pH 7.0), 5mM divalent magnesium ions, 10mM potassium phosphate (pH 7.0), 1U starch phosphorylase, 1U laminaribiose phosphorylase, 10mg The IA-treated starch and different concentrations of glucose (60-150 mM) were catalyzed at 50° C. for 24 hours. The detection of laminaribiose is the same as in Example 1. The result is as Figure 5A , as the glucose concentration increases, the production of laminaribiose increases, but after the glucose concentration is grea...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for constructing an in vitro multienzyme molecule machine and preparing laminaribiose by multienzyme cascade catalyzing, and belongs to the field of preparation of enzyme catalysis of laminaribiose. The preparation method of the laminaribiose disclosed by the invention comprises the following steps of converting glucose units in starch into glucose-1-phosphoric acid through glucanphosphorylase, and performing synthesis on the glucose-1-phosphoric acid and glucose through laminaribiose phosphorylase to obtain the laminaribiose. In the process, other auxiliary enzymes, such as isoamylase and glucantransferase, for enabling the starch to be subjected to complete phosphorus desorption are added, so that the utilization rate of the starch and the final concentration of the laminaribiose can be increased. The technical method has the advantages that substrates are cheap and easy to obtain, the production cost is low, the yield of products is high, and separation and purification are simple. The large-scale production of the laminaribiose can be realized.

Description

technical field [0001] The invention belongs to the field of biomanufacturing, and in particular relates to a method for preparing laminaribiose by in vitro enzymatic method using starch and glucose as raw materials. Background technique [0002] Laminaribiose is an oligosaccharide linked by β-1,3 glycosidic bonds, which is mainly used in the agricultural field and can be used as a natural preservative. [0003] At present, the production of kelp disaccharide is mainly the traditional dilute acid hydrolysis of pine needles or kelp and other polysaccharides. The yield of this process is low, and the cost of separation and extraction is high, resulting in the high price of laminaribiose. Laminaribiose can also be prepared by chemical synthesis, using halogen glycosyl as a glycosyl donor, and obtaining laminaribiose through O-glycosylation derived from the Koenigs-Knorr method. However, the final product is not easy to purify and the final yield is less than 10%. [0004] Wi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12P19/12
Inventor游淳孙尚尚
OwnerTIANJIN INST OF IND BIOTECH CHINESE ACADEMY OF SCI