A gene pemir393a regulating adventitious root development in poplar and its application
A root development and genetic technology, applied in the fields of application, genetic engineering, plant genetic improvement, etc., can solve the problems of decreased sensitivity to auxin, decreased number of lateral roots in Arabidopsis roots, etc., and achieve the effect of reducing the number of lateral roots
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0034] Example 1: Cloning of the PeMIR393a gene
[0035] Using the DNA of Populus Nanlin 895 as the material, referring to the genome sequence information of poplar (http: / / www.phytozome.net / ), the PeMIR393a gene sequence was searched, and the Oligo 7 software was used to design degenerate primers to amplify the PeMIR393a gene sequence with high fidelity. The PCR reaction system is shown in Table 1. Wherein, the degenerate primers include: forward primer: 5'CCAGGAAGC TGGTGGAGGACTCC 3'; reverse primer: 5'GAAGGCGCGAGTGGAAAATTCCA3'.
[0036] Among them, the DNA of Nanlin 895 poplar was extracted using a novel genomic DNA extraction kit (DP320) produced by Tiangen Biochemical Technology (Beijing) Co., Ltd.
[0037] Table 1 High-fidelity PCR reaction system
[0038]
[0039] The reaction conditions were as follows: (1) pre-denaturation at 94°C for 3 min; (2) 94°C for 30s-60°C for 30s-72°C for 2min) × 38 cycles; (3) 72°C for 10 min. The amplified product was sequenced to obtai...
Embodiment 2
[0040] Example 2 Construction of p35S-pBI121-PeMIR393a vector
[0041] (1) Small amount of p2GW7.0-PeMIR393a entry vector was extracted by alkaline lysis method; 35S-pBI121-GUS expression vector was extracted in small amount by alkaline lysis method; p2GW7.0-PeMIR393a entry vector and 35S-pBI121-GUS expression vector were extracted using LRClonaseTM II Plus enzyme mix was connected, reacted at 25°C for 2h, added 0.5 μl of proteinase K, mixed gently, and then placed at 37°C for 10min reaction to extinguish the enzyme to obtain the p35S-pBI121-PeMIR393a vector. The LR cloning reaction system is shown in Table 3.
[0042] Wherein, the preparation steps of the p2GW7.0-PeMIR393a entry vector (BP clone) are as follows: the PeMIR393a obtained by PCR amplification in Example 1 is subjected to agarose gel electrophoresis, using a recovery kit (thin agarose gel DNA recovery kit, GK2043 -50. Shanghai Jierui Biological Engineering Co., Ltd.) purifying and recovering the target product; m...
Embodiment 3
[0050] Example 3 PeMIR393a gene regulates plant adventitious root development
[0051] Through the electric shock conversion method (Bio-Rad MicroPulser Bole electric transfer instrument; electric shock cup: Bio-Rad Bole electric shock cup 1652086; electric shock conditions: output range 200-3000v, precision 10v, using voltage 2.5kv, time constant 1.0ms, precision 0.1ms, Use temperature: room temperature; resistance: Rifampicin Rif) The constructed p35S-pBI121-Pe MIR393a was transformed into Agrobacterium strain LBA4404 (Invitrogen), and the Agrobacterium-mediated technology (He Guangyuan. Plant Genetic Engineering Experiment Manual [M] ]. Beijing: Tsinghua University Press, 2007) The PeMIR393a gene was transferred into Shanxin Yang. Pe-MIR393a transgenic plants were subcultured for about 6 weeks to observe the development of adventitious roots. The rooting speed of transgenic plants was significantly slower than that of non-transgenic plants, and the number of lateral roots ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


