Recombinant baculovirus, raccoon dog parvovirus recombinant subunit vaccine and preparation method of raccoon dog parvovirus recombinant subunit vaccine

A technology for recombining baculovirus and parvovirus, applied in the fields of botanical equipment and methods, biochemical equipment and methods, vaccines, etc., can solve the problems of high serum prices, virus destruction, incomplete inactivation, etc.

Inactive Publication Date: 2019-10-11
JL TEYAN BIOLOGICAL TECH LIMITED LIABILITY
View PDF4 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The inactivating agent-formaldehyde used in the inactivation process of the inactivated vaccine will destroy the protein of the virus to a certain extent, and if the inactivation is not complete, there will be a risk of spreading the virus. The inactivated vaccine can only stimulate the body to produce body fluids Disadvantages such as immunity and short duration of antibodies
In addition, traditional spinner bottle culture needs to use serum-containing medium for culture, but the price of serum remains high at present, and more manpower is used for spinner bottle culture, which directly results in high cost of spinner bottle culture
[0007] Currently there is no specific vaccine for raccoons against RDPV

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant baculovirus, raccoon dog parvovirus recombinant subunit vaccine and preparation method of raccoon dog parvovirus recombinant subunit vaccine
  • Recombinant baculovirus, raccoon dog parvovirus recombinant subunit vaccine and preparation method of raccoon dog parvovirus recombinant subunit vaccine
  • Recombinant baculovirus, raccoon dog parvovirus recombinant subunit vaccine and preparation method of raccoon dog parvovirus recombinant subunit vaccine

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0072] The preparation method of the raccoon parvovirus recombinant subunit vaccine of the present invention is a full-suspension, serum-free culture method, which mainly includes the following steps:

[0073] Step 1. Prepare seed cells by culturing high Five cells in serum-free full suspension in Erlenmeyer shake flasks;

[0074] Step 2. Inoculate the seed cells directly into the bioreactor to culture high Five cells in full suspension, and enlarge the cultivation scale of the bioreactor to a 30L cell tank;

[0075] Step 3: Culture the recombinant baculovirus in full suspension without serum in a conical flask, inoculate it into the cultured cells in the above 30L bioreactor at a multiplicity of infection of 0.5-5.0, and culture for 72-140 hours;

[0076] Step 4: Harvest the supernatant of the above-mentioned culture solution, inactivate it, add aluminum hydroxide glue and mix it to make a vaccine, that is, the raccoon parvovirus recombinant subunit vaccine.

[0077] The rac...

Embodiment 1

[0079] The construction of embodiment 1 recombinant baculovirus

[0080] 1. Acquisition of raccoon parvovirus (RDPV) structural protein VP2 gene

[0081] Design primers (synthesized by Shanghai Sangon) VP2-U (sequence 1) / VP2-L (sequence 2) according to the RDPV LN strain gene sequence preserved by our company, and use PCR to amplify the VP2 gene. The amplification results are as follows figure 1 As shown, the amplified fragment is the same size as the target fragment.

[0082] VP2-U: 5'GGATCCACCATGGGTGATGGAG 3' (SEQ ID NO: 1)

[0083]VP2-L: 5' CCGCTCGAGTCAATATAATTTTCTAGG 3' (SEQ ID NO: 2)

[0084] The PCR amplification conditions are:

[0085]

[0086] It can be seen from the figure that the size of the amplified fragment is consistent with that of the VP2 gene.

[0087] 2. Construction of a shuttle vector containing the VP2 gene of the raccoon parvovirus (RDPV) structural protein

[0088] The PCR products obtained above were double-digested with restriction endonuclea...

Embodiment 2

[0147] Embodiment 2 produces the preparation and preservation of seed virus batch

[0148] The recombinant baculovirus preparation process mainly includes recombinant baculovirus (P1 virus). The seed poison for production is to add 10% fetal bovine serum to the first generation poison and store in -80°C. The seed virus batch for production is usually prepared by infecting sf9 cells with subpackaged and preserved P1 virus to prepare P2 virus, and so on to prepare P3 virus.

[0149] Example 3 Vaccine Production

[0150] 1. Resuscitate 1ml of the seed cells of frozen sf9 insect cells in 100ml of serum-free medium, place them in a 500ml screw-top glass Erlenmeyer shaker flask for culture, the temperature of the shaker is 27°C, and the speed is 110r / min; after 48 hours of culture, add 200ml of serum-free medium Serum culture medium, diluted and passaged in a 3000ml screw-top glass Erlenmeyer flask; after 48 hours of culture, add 400ml of serum-free medium; every 48 hours, 1:2 dil...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
Login to View More

Abstract

The invention provides a recombinant baculovirus, a raccoon dog parvovirus recombinant subunit vaccine and a preparation method of the raccoon dog parvovirus recombinant subunit vaccine, and relates to the field of animal biological products and the biological field. The recombinant baculovirus was preserved in the General Microbiological Center of China Committee for Culture Collection of Microorganisms on April 1st, 2019, the preservation number is CGMCC NO.17486, and the recombinant baculovirus is named as recombinant autographa california nuclear polyhedrosis virus ACMPV-VP2. The recombinant baculovirus capable of expressing RDPV-VP2 protein is built first and inoculated into insect cells to produce the RDPV subunit vaccine. The vaccine prepared from the recombinant baculovirus contains recombinant RDPV capsid protein and contains no RDPV viral genome components, so that the risks of epidemic diffusion and genome release are avoided. The disadvantage that a traditional vaccine preparation technology is high in cost is avoided, and the vaccine fills in the gap that there is no parvovirus vaccine special for racoon dogs currently.

Description

technical field [0001] The invention relates to the field of veterinary biological products and biotechnology, in particular to a recombinant baculovirus, raccoon parvovirus recombinant subunit vaccine and a preparation method thereof. Background technique [0002] Raccoon dog viral enteritis (RDVE) is an acute and highly contagious disease caused by raccoon dog parvovirus (RDPV). The disease is mainly characterized by diarrhea and has a high incidence rates and mortality. [0003] RDPV belongs to the family Parvoviridae and the genus Parvovirus in classification, and is a non-enveloped single-stranded DNA virus. RDPV mainly encodes two structural proteins: VP1 and VP2, VP2 is located at the C-terminal of VP1, the N-terminal amino acid sequence of VP2 protein and the C-terminal amino acid sequence of VP1 protein overlap each other, and both end at the same codon (ParrishCR, 1999) . VP1 protein contains 727 amino acids, which contains 584 amino acids of VP2 protein and a u...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N7/01C12N15/866A61K39/23A61K39/39A61P31/20C12R1/93
CPCA61K39/12A61K39/39A61K2039/5256A61K2039/552A61K2039/55505A61P31/20C12N7/00C12N15/86C12N2710/14121C12N2710/14143C12N2710/14152C12N2750/14334
Inventor倪佳任飞唐毓赵江平吕文雪闫如勋许皓王春霞李云松杨升
OwnerJL TEYAN BIOLOGICAL TECH LIMITED LIABILITY