Kluyvera intermedia tyrosine phenol-lyase mutant and application thereof

A technology of Kluyverella and tyrosine phenol, which is applied in the field of biocatalysis, can solve the problem of low TPL enzyme activity, and achieve the effect of simple and easy operation

Active Publication Date: 2019-10-15
ZHEJIANG UNIV OF TECH +1
View PDF29 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] At present, TPL is still subject to many restrictions in industrial applications.
Most importantly, the TPL enzyme activity is low and still needs to be further improved

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Kluyvera intermedia tyrosine phenol-lyase mutant and application thereof
  • Kluyvera intermedia tyrosine phenol-lyase mutant and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0023] Cloning of embodiment 1 tyrosine phenol lyase gene (KI-TPL)

[0024] By designing primers YW118 (SEQ ID NO.5: 5'CACTGGATCCATGATTTACCC GGCCGAACC 3') and YW119 (SEQ ID NO.6: 5'TTCGAAGCTTTTAAATGT ATTCAAAGCGTGCGG 3'), Kluyvera intermedia (Kluyvera intermedia, purchased from China Industrial The genome of Microorganism Culture Collection Management Center) was used as a template to amplify KI-TPL, and the cloned sequence is shown in SEQ ID NO.1. The amplification system was 50 μL (2×PrimeSTAR Max DNA polymerase (purchased from Beijing Baoriyi Biological Co., Ltd.) 25 μL, 1 μL YW118+1 μL YW119, 1 μL K.intermedia genome, distilled water to 22 μL), pre-denaturation at 95°C for 3 minutes, Denature at 98°C for 10 seconds, anneal at 58°C for 15 seconds, extend at 72°C for 2 minutes (30 cycles), and extend again at 72°C for 10 minutes.

[0025] After recovering the KI-TPL fragment obtained above using a gel recovery kit (purchased from Beijing Baoriyi Biological Co., Ltd.), it was...

Embodiment 2

[0026] The construction of embodiment 2 mutation library

[0027] Using an adjustable error-prone PCR kit (purchased from Beijing Tianenze Gene Technology Co., Ltd.), with primers YW117 and YW118, PCR random mutation of KI-TPL was carried out, and 2-4 mutation sites were controlled. The mutation system was 30 μL (3 μL 10 × Error-prone Mix, 3 μL error-prone dNTP, 3 μL MnCl 2 , 1 μL K.intermedia genome, 1 μL Taq DNA polymerase, 1 μL YW118+1 μL YW119, 17 μL distilled water). PCR amplification conditions were pre-denaturation at 94°C for 3 minutes, denaturation at 94°C for 1 minute, annealing at 58°C for 1 minute (30 cycles), and extension at 72°C for 1 minute. The KI-TPL fragment amplified by the above random mutation was digested with restriction endonucleases BamH I and Hind III, ligated with the pET-28a(+) vector cut with the same BamH I and Hind III, and transferred into BL21 , to construct a mutant library.

Embodiment 3

[0028] Example 3 Screening of mutant library

[0029]The screening of the mutant library was carried out as described in (XL Tang, etal. Analytical Biochemistry. 2018.560:7–11), using the principle of color reaction between pyruvate and salicylaldehyde. The specific steps are as follows: the mutants were picked and inoculated in a test tube containing 3 mL of LB medium, cultured for 24 hours, then added with 0.2 mM IPTG for induction for 12 hours, and centrifuged at 4000 rpm for 5 minutes to collect the bacteria. Add the bacteria to 600μL reaction solution (10g / L pyruvate, 12.5g / L catechol, 20g / L ammonium acetate, 1g / L EDTA, 0.12g / L PLP, 2g / L sodium sulfite) and react for 20 minutes After the reaction was completed, 400 μL of 1M HCl was added to terminate the reaction. Subsequently, 100 μL reaction solution was mixed with 200 μL 5M NaOH solution, 100 μL 5% (V / V) salicylaldehyde, 600 μL ddH 2 O to mix well, then measure the absorbance value at 465nm. According to the magnitu...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a kluyvera intermedia tyrosine phenol-lyase mutant and an application thereof. A tyrosine phenol-lyase gene from the kluyvera intermedia is cloned, random mutation is conductedon the tyrosine phenol-lyase gene, and the mutated gene is expressed in escherichia coli to obtain an engineering bacterium YW021 of which the enzyme activity is greatly improved. The maximum concentration of levodopa synthesized by the engineering bacterium YW021 provided by the invention is as high as 150g / L which is improved by about 30% than that of a wild type, and the conversion rate of zymolyte catechol is 99.9% or more.

Description

technical field [0001] The invention belongs to the technical field of biocatalysis, in particular to a tyrosine phenol lyase (Tyrosine Phenol-Lyase, TPL) mutant derived from Kluyvera intermedia and its role in catalyzing the synthesis of L-polysaccharide application on the bus. Background technique [0002] Levodopa (3,4-dihydroxyphenylalanine), also known as L-dopa, is the prodrug of dopamine, which itself has no pharmacological activity. It enters the central system through the blood-brain barrier and is converted into Dopamine plays a pharmacological role and is often used in the drug treatment of Parkinson's. With the aggravation of global aging, the number of Parkinson's patients is increasing day by day. According to the research report of the United States, the global demand for levodopa will double by 2030. [0003] Traditional methods for preparing levodopa mainly include extraction from plants (cat beans, quinoa beans, etc.), and multi-step synthesis through org...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/60C12N9/88C12N15/70C12N1/21C12P13/22C12R1/19
CPCC12N9/88C12N15/70C12P13/225C12Y401/99002
Inventor袁围钟爽肖延铭张飞龙汪钊祁瑛李敬亚
OwnerZHEJIANG UNIV OF TECH