Zymomonas mobilis genome editing method based on CRISPR-Cas12a system and application of method

A Zymomonas, genome editing technology, applied in the field of gene editing, can solve the problems of restricting research and application, large workload, long time consumption, etc., and achieves the effect of wide application range, simple operation and simple process

Active Publication Date: 2019-10-22
武汉睿嘉康生物科技有限公司
View PDF3 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The classic genome editing technology mainly relies on the host's own homologous recombination (homologous recombination) system to complete the modification of individual specific genes, and the use of suicide plasmids or unstable replication vectors to modify the genome often requires the introduction of specific screening markers or Counter-selection systems, but they have the disadvantages of low efficiency, long time-consuming, and heavy workload, and these systems are usually limited by available selection markers and recombinant enzyme expression systems in the host, which severely restricts related research and applications

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Zymomonas mobilis genome editing method based on CRISPR-Cas12a system and application of method
  • Zymomonas mobilis genome editing method based on CRISPR-Cas12a system and application of method
  • Zymomonas mobilis genome editing method based on CRISPR-Cas12a system and application of method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] Example 1 Construction of an inducible gene editing system suitable for Zymomonas mobilis

[0040] The present invention uses Zymomonas mobilis ZM4 as a model strain, and realizes directional editing of the genome by constructing an inducible gene editing system suitable for Zymomonas mobilis. The specific experimental process is as follows:

[0041] 1. Construction of an inducible Cas12a recombinant strain

[0042] In the present invention, firstly, the nuclease Cas12a derived from Francisella novicida was integrated into the ZMO0038 site in the Z.mobilis ZM4 genome by the method of homologous recombination, and an inducible promoter was used to control the expression of the nuclease. Recombinant strain ZM-Cas12a.

[0043] The specific construction process is as follows:

[0044] (1) Construction of recombinant plasmid

[0045]The Cas12a gene sequence, the resistance selection marker (spectinomycin), the inducible promoter gene sequence (tetracycline-inducible promo...

Embodiment 2

[0073] Example 2 Application of Zymomonas mobilis genome editing method based on CRISPR-Cas12a system in elimination of endogenous plasmids

[0074] 1. Selection of target sites

[0075] The genomic data of Z. mobilis ZM4 has been published, which contains 4 endogenous plasmids and named according to the size of the sequences as pZM32 (32,791bp), pZM33 (33,006bp), pZM36 (36,494bp) and pZM39 (39,266bp) . Sequence analysis showed that the four endogenous plasmid strains edit the replicase. If the replicase is inactivated, the endogenous plasmid will lose the ability to replicate and the endogenous plasmid will be eliminated from the strain.

[0076] The present invention selects a sequence of 23 bp downstream of the TTTN site of the PAM site from the replicase gene of the endogenous plasmid as the targeting guide sequence of the guide RNA in the construction of the target plasmid to guide the cleavage of the target site by the nuclease. The forward primer is 5'-AGAT+(target se...

Embodiment 3

[0105] Example 3 Application of Zymomonas mobilis genome editing method based on CRISPR-Cas12a system in point mutation

[0106] 1. Selection of target sites

[0107] Select ZMO1237 in the Z. mobilis ZM4 genome as the target site, perform point mutation on it, and select the 23bp sequence downstream of the PAM site TTTN site from the target gene as the targeting guide sequence for constructing the guide RNA in the target plasmid, and guide the nuclease Cleavage of target sites. The forward primer is 5'-AGAT+(target sequence)-3', and the reverse primer is 5'-TGAC+(target sequence complementary sequence)-3'.

[0108] The sequence of the guide RNA primer is as follows, where the underlined part is complementary to the enzyme cutting site:

[0109] Ldh-F: AGAT GTAAGCCGCTCATTCAGAAAAAC, see SEQ ID NO: 15;

[0110] Ldh-R: TGAC GTTTTTCTGAATGAGCGGCTTAC, see SEQ ID NO:16.

[0111] 2. Construction of target plasmids

[0112] Ligate the guide RNA primer sequence to the editing pl...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of gene editing, and particularly relates to a Zymomonas mobilis genome editing method based on a CRISPR-Cas12a system and application of the method. The method for editing a Zymomonas mobilis genome is established on the basis of the CRISPR-Cas12a system with Zymomonas mobilis (ZM4) as the modulus strain, the oriented editing of the genome is realized,a gene editing tool is provided for developing the rational design of an allogenic metabolic pathway and cell factory for producing biomass fuel and biological materials in the strain, and the development in metabolic engineering and related research fields is promoted. The method is technically characterized by including the steps of establishing an inducible expression Cas12a recombinant strainand an editing plasmid containing an artificial CRISPA expression unit, designing guiding RNA, connecting the guiding RNA to the editing plasmid after annealing the primer sequence of the guiding RNA, and shifting a target plasmid into a competent cell for expression editing.

Description

technical field [0001] The invention belongs to the technical field of gene editing, and in particular relates to a genome editing method of Zymomonas mobilis based on the CRISPR-Cas12a system and its application. Background technique [0002] In recent years, with the development and progress of synthetic biology technology, the use of microorganisms for metabolic engineering and systems biology research has received more and more attention. The production of biofuels and value-added chemicals from inexpensive renewable resources using microorganisms as a carrier provides an alternative solution to the shortage of fossil resources and the related environmental problems caused by them. As a natural ethanol-producing strain, Zymomonas mobilis has a unique ED metabolic pathway, high sugar fermentation efficiency, high ethanol yield, low yield, strong ethanol tolerance, and high osmotic pressure resistance. Ideal for industrial cell factories, it is currently one of the prefer...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/113C12N15/90C12N1/21C12R1/01
CPCC12N15/113C12N15/902C12N2310/10C12N2310/20C12N1/205C12R2001/01
Inventor杨世辉沈威彭文舫马立新
Owner武汉睿嘉康生物科技有限公司