Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Preparation method of porcine circovirus type 3 (PCV-3) Cap protein virus-like particles and application thereof

A porcine circovirus and virus-like technology is applied in the field of preparation of porcine circovirus type 3 Cap protein virus-like particles, which can solve the problems of low secretion efficiency, low solubility of target protein, low production cost, etc., and improve the expression efficiency of yeast Effect

Inactive Publication Date: 2020-01-14
TIANJIN RINGPU BIO TECH
View PDF3 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Choosing an appropriate expression system is an important factor for the successful preparation of VLPs. The prokaryotic expression system is cheap and easy to scale up, and can produce a large amount of foreign protein. However, the low solubility and incorrect folding of the target protein limit its practical use.
The yeast expression system also does not require expensive media, the production cost is low, and it can be produced on a large scale. Yeast can grow as fast as E. coli, and the risk of foreign factor contamination is low. It also has the endoplasmic reticulum (ER) as a monitor for correctly folded proteins system, capable of producing virus-like particles of reliable quality, but yeast expression also has defects, such as lack of strong and tightly regulated promoters, low secretion efficiency, etc.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation method of porcine circovirus type 3 (PCV-3) Cap protein virus-like particles and application thereof
  • Preparation method of porcine circovirus type 3 (PCV-3) Cap protein virus-like particles and application thereof
  • Preparation method of porcine circovirus type 3 (PCV-3) Cap protein virus-like particles and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] Example 1. Preparation of virus-like particles of recombinant porcine circovirus expressed by Saccharomyces cerevisiae

[0038] 1. Obtain the recombinant PCV3-Cap protein gene sequence

[0039] (1) Obtain the immunogenic gene Cap of PCV3 from the plasmid containing the whole genome sequence of PCV3 preserved by our company.

[0040] (2) Design primers A1, A2, B1, and B2 (see Table 1 for the sequence), and use Overlap PCR to add a signal peptide sequence before the Cap region, as follows:

[0041] (5'-ATGATGGTGTCCTTCACCTCCCTCCTCGCCGGCGTCGCCGCCATCTCGGGCGTCTTGGCCGCTCCCGCCGCCGAGGTCGAATCCGTGGCTGTGGAGAAGCGC-3')

[0042] (3) Then optimize the sequence after adding the signal peptide. The specific method is: add the restriction site of BsaI and the base sequence (GATG) for the correct connection of the transcription units in order at the 5' end of the signal peptide, ORF2 His6-Tag (5'-CATCATCACCATCACCAT-3'), BsaI enzyme cutting site and base sequence (TAGC) for the correct co...

Embodiment 2

[0056] Example 2. Preparation of virus-like particles of recombinant porcine circovirus expressed in Escherichia coli

[0057] 1. The Cap protein obtained in 1. of Example 1 was optimized according to the codon preference of E. coli, and then transformed into the expression host E. coli BL21. Correct clones were obtained by screening LB plates with kana resistance.

[0058] 2. Induced expression of recombinant bacterial Cap protein

[0059] 1) Pick a single colony from the resistant plate and inoculate it in a medium containing LB, and culture it overnight at 37°C;

[0060] 2) Transfer the bacterial solution obtained in step 1 to a 500 mL Erlenmeyer flask containing 50 mL of LB medium at an inoculum size of 1%, and culture it with shaking at 37°C until OD 620nm is 0.6;

[0061] 3) Add IPTG with a final concentration of 1 mM to the above culture medium, and induce expression at 16° C. for 8 h on a shaker.

[0062] 4) Collect the cells and wash them twice with PBS, then resu...

Embodiment 3

[0074] Example 3. Vaccine preparation and immune test of virus-like particles of recombinant porcine circovirus

[0075] 1. Vaccine Preparation

[0076] The virus-like particles of the group of porcine circoviruses expressed by Saccharomyces cerevisiae in Example 1 are mixed with aluminum hydroxide glue and recorded as Z; the virus-like particles of the group of porcine circoviruses expressed by E. Particles are mixed with aluminum hydroxide glue and recorded as Y, and the virus-like particles of the recombinant porcine circovirus without adding signal peptide PCV3-Cap protein in Comparative Example 1 are mixed with aluminum hydroxide glue and recorded as Y. For Z-1, the virus-like particles of the group porcine circovirus expressed by Pichia pastoris in comparative example 3 are mixed with aluminum hydroxide glue and recorded as Z-B, and the above-mentioned 4 kinds of vaccines are used according to the "People's Republic of China Veterinary Medicine Code "for sterility test,...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a preparation method of porcine circovirus type 3 (PCV3) Cap protein virus-like particles and an application thereof. The method is based on comparative analysis of Cap proteingene sequences of PCV3 epidemic strains, a yeast expression signal peptide sequence is added to the front end of an artificially synthesized PCV3-Cap protein coding gene, codons of the Cap gene are optimized, a recombinant saccharomyces cerevisiae expression strain is constructed by using a saccharomyces cerevisiae transcription element efficient construction method, and virus-like particles of the recombinant porcine circovirus are generated through induced expression. A subunit vaccine is prepared from the Cap protein expressed by the recombinant saccharomyces cerevisiae expression strain,an organism can be induced to generate specific immune response after animals are immunized, and a pig body can be protected against attack of the porcine circovirus.

Description

technical field [0001] The invention belongs to the field of genetic engineering vaccines, in particular to a preparation method and application of porcine circovirus type 3 Cap protein virus-like particles. Background technique [0002] Porcine circovirus (PCV) is one of the smallest animal viruses discovered so far. There are three serotypes of the virus: PCV1, PCV2 and PCV3. PCV1 has no pathogenicity, PCV2 can cause porcine dermatitis nephrotic syndrome, granulomatous enteritis, multisystem failure syndrome of weaned piglets and sow reproductive disorders, etc. Not yet clear. The PCV3 virus contains three major open reading frames (ORFs). Among them, ORF2 encodes the capsid protein Cap, and the Cap protein is the only structural protein that constitutes the viral capsid. The genome structure of PCV3 is similar to that of PCV1 and PCV2, but the homology between PCV3 and PCV2 is low, only about 30%. Therefore, the vaccine against PCV2 virus cannot play an effective immu...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K14/01C12N15/34C12N15/81A61K39/12A61P31/20
CPCC07K14/005C12N15/81A61K39/12A61P31/20C12N2750/10022C12N2750/10023C12N2750/10034C12N2800/22A61K2039/5258A61K2039/552
Inventor 李守军黄金海杨保收付旭彬吕茂杰厚华艳
Owner TIANJIN RINGPU BIO TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com