PAL recombination protein of acinetobacter baumannii and coding gene and application of PAL recombination protein
A technology of recombining proteins and genes, applied in the field of genetic engineering, can solve problems such as hidden safety hazards and complex vaccine components, and achieve the effects of maintaining spatial conformation, quality and safety controllable, and maintaining immunogenicity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment approach
[0048] According to a preferred embodiment of the present invention, the recombinant protein has a GTS tag attached to the N-terminus of the amino acid sequence shown in SEQ ID NO: 1 or SEQ ID NO: 3, and the use of this tag makes the purification conditions mild , The steps are simple and do not require the addition of denaturants, so that the purified protein can maintain its spatial conformation and immunogenicity to the greatest extent.
[0049] The above-mentioned recombinant protein can be obtained by artificial synthesis, or its coding gene can be synthesized first, and then obtained by biological expression.
[0050] In the second aspect, the present invention also provides a gene capable of encoding the above-mentioned recombinant protein.
[0051] It is well known in the art that among the 20 different amino acids that make up proteins, except that Met (ATG) or Trp (TGG) are encoded by single codons respectively, the other 18 amino acids are encoded by 2-6 codons resp...
Embodiment 1
[0093] This example is used to illustrate the construction of the recombinant vector containing the gene encoding the recombinant protein of the present invention
[0094] 1. Obtaining the target gene
[0095] 1) Entrust Shanghai Sangon to synthesize the forward primer PBA71_01439-86B2 (SEQ ID NO: 5`-CGC GGATCC AAGCCAGCAACAACGGCAAC), reverse primer PBA71_01439-86N2 (SEQ ID NO: 6, TTATGCGGCCGCTTATTTTAAT AGAGGAGGAA CC) (the base sequence of the restriction site is underlined).
[0096] 2) Take out the preserved Acinetobacter baumannii LAC-4 strain from the -80□ freezer, spread it on the LB solid medium after thawing, cultivate it overnight at 37□, and then pick a single colony and inoculate it in the LB liquid medium After culturing for 5 hours, the whole genome was extracted according to the bacterial genome extraction kit.
[0097] 3) Using the whole genome DNA of Acinetobacter baumannii LAC-4 as a template to PCR amplify the PAL protein gene fragment shown in SEQ ID NO:2...
Embodiment 2
[0125] This example is used to illustrate the induction expression, purification and expression form identification of PAL recombinant protein in prokaryotic expression system-Escherichia coli
[0126] 1. Induced expression of recombinant protein
[0127] 1) Take 100 μL of the correct pGEX-6P-2-PAL / XL-1blue bacterial solution identified in Example 1 by double enzyme digestion, add it to 10 mL of Amp-resistant LB medium, and culture overnight at 100 rpm at 37°C, and take the overnight cultured bacterial solution respectively Add 2ml to 18mL Amp-resistant LB medium (the rest of the bacterial solution is stored in a refrigerator at 4°C for later use), incubate at 37°C for 2-3 hours, rotate at 250rpm, and reactivate until the OD 600 is 0.8-1.2, then add IPTG 2.2 μL to a final concentration of 100 μM, and induce expression overnight at 30°C.
[0128] 2) Take out the bacterial solution after induction of expression, centrifuge at 1000rpm for 2min, discard the supernatant, add 1mL...
PUM
| Property | Measurement | Unit |
|---|---|---|
| molecular weight | aaaaa | aaaaa |
| purity | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



