Unlock instant, AI-driven research and patent intelligence for your innovation.

PAL recombination protein of acinetobacter baumannii and coding gene and application of PAL recombination protein

A technology of recombining proteins and genes, applied in the field of genetic engineering, can solve problems such as hidden safety hazards and complex vaccine components, and achieve the effects of maintaining spatial conformation, quality and safety controllable, and maintaining immunogenicity

Active Publication Date: 2020-02-04
WEST CHINA HOSPITAL SICHUAN UNIV
View PDF4 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, this type of vaccine contains complex vaccine components and has certain potential safety hazards

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • PAL recombination protein of acinetobacter baumannii and coding gene and application of PAL recombination protein
  • PAL recombination protein of acinetobacter baumannii and coding gene and application of PAL recombination protein
  • PAL recombination protein of acinetobacter baumannii and coding gene and application of PAL recombination protein

Examples

Experimental program
Comparison scheme
Effect test

Embodiment approach

[0048] According to a preferred embodiment of the present invention, the recombinant protein has a GTS tag attached to the N-terminus of the amino acid sequence shown in SEQ ID NO: 1 or SEQ ID NO: 3, and the use of this tag makes the purification conditions mild , The steps are simple and do not require the addition of denaturants, so that the purified protein can maintain its spatial conformation and immunogenicity to the greatest extent.

[0049] The above-mentioned recombinant protein can be obtained by artificial synthesis, or its coding gene can be synthesized first, and then obtained by biological expression.

[0050] In the second aspect, the present invention also provides a gene capable of encoding the above-mentioned recombinant protein.

[0051] It is well known in the art that among the 20 different amino acids that make up proteins, except that Met (ATG) or Trp (TGG) are encoded by single codons respectively, the other 18 amino acids are encoded by 2-6 codons resp...

Embodiment 1

[0093] This example is used to illustrate the construction of the recombinant vector containing the gene encoding the recombinant protein of the present invention

[0094] 1. Obtaining the target gene

[0095] 1) Entrust Shanghai Sangon to synthesize the forward primer PBA71_01439-86B2 (SEQ ID NO: 5`-CGC GGATCC AAGCCAGCAACAACGGCAAC), reverse primer PBA71_01439-86N2 (SEQ ID NO: 6, TTATGCGGCCGCTTATTTTAAT AGAGGAGGAA CC) (the base sequence of the restriction site is underlined).

[0096] 2) Take out the preserved Acinetobacter baumannii LAC-4 strain from the -80□ freezer, spread it on the LB solid medium after thawing, cultivate it overnight at 37□, and then pick a single colony and inoculate it in the LB liquid medium After culturing for 5 hours, the whole genome was extracted according to the bacterial genome extraction kit.

[0097] 3) Using the whole genome DNA of Acinetobacter baumannii LAC-4 as a template to PCR amplify the PAL protein gene fragment shown in SEQ ID NO:2...

Embodiment 2

[0125] This example is used to illustrate the induction expression, purification and expression form identification of PAL recombinant protein in prokaryotic expression system-Escherichia coli

[0126] 1. Induced expression of recombinant protein

[0127] 1) Take 100 μL of the correct pGEX-6P-2-PAL / XL-1blue bacterial solution identified in Example 1 by double enzyme digestion, add it to 10 mL of Amp-resistant LB medium, and culture overnight at 100 rpm at 37°C, and take the overnight cultured bacterial solution respectively Add 2ml to 18mL Amp-resistant LB medium (the rest of the bacterial solution is stored in a refrigerator at 4°C for later use), incubate at 37°C for 2-3 hours, rotate at 250rpm, and reactivate until the OD 600 is 0.8-1.2, then add IPTG 2.2 μL to a final concentration of 100 μM, and induce expression overnight at 30°C.

[0128] 2) Take out the bacterial solution after induction of expression, centrifuge at 1000rpm for 2min, discard the supernatant, add 1mL...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
purityaaaaaaaaaa
Login to View More

Abstract

The invention relates to the field of genetic engineering, and discloses PAL recombination protein of acinetobacter baumannii and a coding gene and application of the PAL recombination protein. The PAL recombination protein is (a) recombination protein as shown in SEQID NO:1 or SEQID NO:3; and (b) protein which is obtained by substituting, deleting and adding one or more amino acids for the aminoacid sequence as shown in SEQ ID NO:1 or SEQID NO:3, and has the same function as the recombination protein as shown in SEQID NO:1 or SEQID NO:3 and derived from (a) or protein which is prepared by connecting labels to the terminal of amino terminal and / or carboxyl terminal of the SEQID NO:1 or the SEQID NO:3 and shown in the amino acid sequence. The recombination protein is high in expression level, convenient to separate and purify, and high in efficacy and safe, can directly cooperate with an adjuvant for preparing a subunit vaccine and a relevant detection product, for resisting infectionof the acinetobacter baumannii.

Description

technical field [0001] The invention relates to the field of genetic engineering, in particular to a PAL recombinant protein of Acinetobacter baumannii and its encoding gene and their application. Background technique [0002] Acinetobacter baumannii has become a pathogen that threatens human health worldwide. In 2017, the WHO released a report listing 12 severe drug-resistant bacteria that seriously threaten human health, among which Acinetobacter baumannii ranked "top of the list". It can cause various types of infections including pneumonia, bacteremia, meningitis, trauma infections and urinary tract infections. my country's CHINET bacterial drug resistance monitoring system shows that the resistance of Acinetobacter baumannii to various antibiotics has reached more than 50%. The mortality rate caused by drug-resistant Acinetobacter baumannii is as high as 30%. In recent years, the emergence of multidrug-resistant and pan-drug-resistant Acinetobacter baumannii has brou...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K14/21C12N15/31C12N15/11C07K16/12C12N15/70C12N1/21A61K39/104A61P31/04C12R1/19
CPCC07K14/212C12N15/70C07K16/1214A61K39/1045A61P31/04A61K2039/523Y02A50/30
Inventor 石云郭刚王宁李彦刘开云
Owner WEST CHINA HOSPITAL SICHUAN UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More