A method for detecting the conformational change during the binding process of aptamer and ligand small molecule

A technology of combining process and aptamer, applied in the field of biomedicine

Active Publication Date: 2020-11-24
SECOND MILITARY MEDICAL UNIV OF THE PEOPLES LIBERATION ARMY
View PDF6 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] However, there is a method to quickly and effectively detect conformational changes during the binding process of aptamers and ligand small molecules through biofilm interference experiments, surface-enhanced Raman spectroscopy, and molecular dynamics simulations. Not yet reported

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A method for detecting the conformational change during the binding process of aptamer and ligand small molecule
  • A method for detecting the conformational change during the binding process of aptamer and ligand small molecule
  • A method for detecting the conformational change during the binding process of aptamer and ligand small molecule

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0049] Embodiment 1: BLI measures the affinity between the small molecule theophylline and its aptamer RNA

[0050] The affinity between theophylline small molecule and its aptamer was determined by BLI technology, and at the same time, a 21-base RNA sequence (NC: UUGUACUACACAAAAAGAUACUG, SEQ ID NO.2) was randomly selected as a negative control and theophylline reaction, and determine its affinity constant K under the same conditions as the aptamer d value.

[0051] First, use buffer (Tris-HCl buffer+10mM MgSO 4 ,pH 7.4) to prepare 10μM theophylline solution, 500nM aptamer RNA (with biotin at the 5' end) solution and 500nM NC (with biotin at the 5' end) solution, and all the RNA solutions should be used immediately Ready to serve, store in ice box to prevent degradation. Then add 200 μL each of prepared aptamer solution, NC solution, theophylline, and buffer solution into each reaction well, and then dip the chip connected with streptomycin into each reaction well according...

Embodiment 2

[0052] Example 2: Weak binding of aptamer RNA to a SERS substrate

[0053] First by the Lee method (Lee, P.C.; Meisel, D.Adsorption and surface-enhanced Ramanof dyes on silver and gold sols. The Journal of Physical Chemistry 1982,86,3391-3395.) to prepare silver colloid solution, and the obtained silver The gel solution is concentrated about 60 times by centrifugation and removing the supernatant, so as to enhance the Raman signal of the substance to be tested. However, when the silver colloid is concentrated, the impurities on the surface of the silver nanoparticles (AgNPs) are also enriched, showing a strong Raman signal, even exceeding the signal of the substance to be tested. Therefore, we added 5 μL 1mM KI solution to 10 μL concentrated silver colloid solution to clean the citrate ions on the surface of silver nanoparticles and make the surface of silver nanoparticles strongly negatively charged (AgNP-I - ). However, due to the presence of a large number of phosphate gr...

Embodiment 3

[0054] Example 3: Changes in the SERS spectra before and after the aptamer binds to theophylline

[0055] After the aptamers were weakly bound to the surface of the silver colloid, 100 μM theophylline solution was added in equal proportions. in Mg 2+ With the help of theophylline and the aptamer, theophylline and the aptamer are mutually induced to combine. Compared with the aptamer, the theophylline molecule has a smaller mass and volume, so in the process of the combination of the two, the conformation of theophylline molecule remains unchanged, while The aptamer continuously changes conformation to accommodate the entry of theophylline, and finally reaches a stable state. At this point, the mixed aptamer-theophylline solution was added to deionized water, diluted to 100 μL, and transferred to a 96-well plate to collect SERS signals. The final detection concentration of the substances to be tested was 10 μM, and the results were as follows: image 3 shown. After theophyl...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of biological medicine, in particular to a method for rapidly and effectively detecting conformational change in the aptamer and ligand small molecule binding process. The method comprises the following steps: determining the affinity between a selected aptamer and small molecules by applying a biological membrane interference experiment; detecting conformational change before and after the aptamer is combined with the small molecules through a surface enhanced Raman scattering spectrum technology; and visually explaining the binding process of theaptamer and the ligand through molecular dynamics simulation. According to the method, theophylline and the aptamer thereof are taken as examples, it is verified that the method provides new idea forresearch on the reliability of the conformational change of the aptamer and design, modification and screening the high-affinity high-selectivity aptamer, and the method can be applied to the fields of detection, sensing, clinical diagnosis and treatment in a better way.

Description

technical field [0001] The invention relates to the technical field of biomedicine, in particular to a fast and effective method for detecting conformational changes in the process of combining an aptamer with a ligand small molecule. Background technique [0002] The nucleic acid aptamer is usually an oligonucleotide sequence screened from a gene library using SELEX (Systematic Evolution of Ligands by Exponential Enrichment) technology. It can bind with corresponding target molecules such as drugs, proteins, nucleic acids or other inorganic and organic molecules with high affinity and strong specificity. At the same time, aptamers have the advantages of thermal stability, salt tolerance, easy synthesis, and low cost, making them gradually become a research hotspot in the fields of detection, sensing, and clinical research (Negri, P.; Chen, G.; Kage, A.; Nitsche, A.; Naumann, D.; Xu, B.; Dluhy, R.A., Direct Optical Detection of Viral Nucleoprotein Binding to an Anti-Influen...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): G01N21/65
CPCG01N21/658
Inventor陆峰崔晓林柳艳袁一凡王梁华柴逸峰
OwnerSECOND MILITARY MEDICAL UNIV OF THE PEOPLES LIBERATION ARMY