L-arabinose epimerase mutant and application thereof

A technology of epimerase and arabinose, which is applied in the field of L-arabinose epimerase mutants, can solve the problems of catalytic efficiency to be improved, low substrate concentration, unfavorable industrial production, etc., and achieve good industrial application foreground effect

Active Publication Date: 2020-03-24
ZHEJIANG UNIV OF TECH
View PDF6 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, the substrate concentration of D-tagatose prepared from D-galactose by biological method is low, all below 100g / L, which is not conducive to the application in industrial production
At present, the problem in the preparation of D-tagatose by LAI is that there are few enzyme sources and the catalytic efficiency needs to be improved.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • L-arabinose epimerase mutant and application thereof
  • L-arabinose epimerase mutant and application thereof
  • L-arabinose epimerase mutant and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0023] Embodiment 1: the screening of novel enzyme

[0024] 1. Source of enzyme and construction of recombinant bacteria

[0025] The sugar isomerases obtained from the NCBI database were derived from Salegentibacteragarivorans (GenBank No. WP_093303409.1), Massilia glaciei (GenBank No. WP_106758181.1), Chitinophagaceae bacterium (GenBank No. WP_153799928.1), and named SaLAI, MgLAI and CbLAI. According to the amino acid sequence, the codon was optimized according to the codon preference of Escherichia coli, and three selected nucleotide sequences were synthesized by the method of total synthesis through the conventional operation of genetic engineering, such as SEQ ID NO.2, SEQ ID NO.4 and shown in SEQ ID NO.6; the amino acid sequences encoding the enzyme are shown in SEQ ID NO.1, SEQ ID NO.3 and SEQ ID NO.5 respectively. Add 6×His-tag tags at the end of the nucleic acid sequence, add restriction sites XbaI and XhoI at both ends, clone the gene into the XbaI and XhoI sites c...

Embodiment 2

[0039] Example 2: Construction and screening of CbLAI single point mutants

[0040] 1. Mutant construction

[0041] According to the CbLAI parental sequence (the amino acid sequence is shown in SEQ ID NO.5, and the nucleotide sequence is shown in SEQ ID NO.6), the mutation primers for site-directed mutation were designed, and the recombinant vector pET28b / CbLAI was used as a template by using rapid PCR technology. To introduce a single mutation at position 97, the primers are:

[0042] Forward primer 97G: CCGGCAAAGATGTGGATCGGT NNN CTAAAAGTAC (the underline is the mutated base)

[0043] Reverse primer 97G: GTACTTTTAG NNN ACCGATCCACATCTTTGCCGG (the underline is the mutated base)

[0044] PCR reaction system: 2×Phanta Max Buffer (containing Mg 2+ ) 25 μL, dNTPs 10 mM, forward primer 97G 2 μL (5 pmol / μL, the same below), reverse primer 97G 2 μL (5 pmol / μL, the same below), template DNA 1 μL (20ng / μL, the same below), Phanta Max Super- Fidelity DNA Polymerase 50U with ddH a...

Embodiment 3

[0056] Example 3: Construction and screening of CbLAI double-site mutants

[0057] According to the sequence of the single mutant CbLAI-1 constructed in Example 2, the mutation primers for site-directed mutation were designed. Using the rapid PCR technology, the recombinant vector pET28b / CbLAI-1 was used as a template to introduce a single mutation at position 189. The primers were:

[0058] Forward primer 189N: TTCGGCGAC NNN ATGAGACAAGTAGCAGTGACAG (the underline is the mutated base)

[0059] Reverse primer 189N: CTGTCACTGCTACTTGTCTCAT NNN GTCGCCGAA (the underline is the mutated base)

[0060] PCR reaction system: 2×Phanta Max Buffer (containing Mg 2+ ) 25μL, dNTPs 10mM, forward primer 189N 2μL, reverse primer 189N 2μL, template DNA 1μL, Phanta Max Super-Fidelity DNA Polymerase 50U, add ddH 2 0 to 50 μL.

[0061] The PCR amplification conditions were 95°C for 3min; (95°C for 15s, 62.5°C for 15s, 72°C for 6.5min) for 30 cycles; 72°C for 5min.

[0062] The PCR product wa...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an L-arabinose epimerase mutant and an application of a L-arabinose epimerase mutant in preparation of D-tagatose through microbial catalysis of D-galactose isomerization. TheL-arabinose epimerase mutant is obtained by site-specific mutagenesis of amino acid, and the site-specific mutagenesis sites are one or more of the following sites: (1) the 97th site, (2) the 189th site, (3) the 301st site, (4) the 409th site and (5) the 462nd site. The invention has the main beneficial effects that the brand-new epimerase and the mutant thereof are provided, and the applicationof the epimerase and the mutant thereof in preparation of D-tagatose is also provided. The mutant has a high optimal reaction temperature of 80 DEG C, and the technical problem that the existing enzyme cannot produce D-tagase at high temperature is solved. When the mutant is used for producing D-tagatose and the concentration of a substrate is 600g / L, the highest product yield can reach 79.7 percent and is superior to the conversion effect of original enzyme and other mutant enzymes, and the mutant has a relatively good industrial application prospect.

Description

[0001] (1) Technical field [0002] The invention relates to an L-arabinose epimerase mutant and its application in the preparation of D-tagatose by microorganism catalyzing the isomerization of D-galactose. [0003] (2) Background technology [0004] D-tagatose is a rare ketohexose found in nature and is an isomer of D-galactose. It was first found in the gum of a tropical evergreen plant, and later found in yogurt and cheese. D-tagatose has the properties and effects of high sweetness, low calorie, low absorption rate, effectively lowering blood sugar, anti-caries, and improving intestinal flora. The US Food and Drug Administration has passed the safety certification of D-tagatose, allowing it to be used in food. The production methods of D-tagatose mainly include chemical method and biological method. The chemical method has problems such as high cost, high acid and alkali consumption, serious pollution, complex product components, and difficult separation and purificatio...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N9/90C12N15/61C12P19/24C12P19/02
CPCC12N9/90C12P19/02C12P19/24C12Y503/01004
Inventor柳志强孙晨奕贾东旭郑裕国金利群彭晨陈德水廖承军程新平李勉毛宝兴
OwnerZHEJIANG UNIV OF TECH