A kind of aspartic acid protease and its coding gene and application

A technology of aspartic acid and protease, applied in the fields of application, genetic engineering, plant genetic improvement, etc., can solve problems such as not meeting industrial application requirements, achieve good industrial application prospects, high optimum reaction temperature, and good thermal stability Effect

Active Publication Date: 2018-10-09
EAST CHINA UNIV OF SCI & TECH
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The purpose of the present invention is to provide a kind of aspartic acid protease and its coding gene and application, thus solve the defect that aspartic acid protease in the prior art is less in line with industrial application requirements

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of aspartic acid protease and its coding gene and application
  • A kind of aspartic acid protease and its coding gene and application
  • A kind of aspartic acid protease and its coding gene and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] Embodiment 1 Amplification of Aspartic Protease Gene

[0033] 1.1 Strains and their cultivation

[0034] The Antarctic low-temperature bacterium Geomycespannorum (bacteria identification NCBI accession number: JF20026, which has been deposited in CCTCC, number AF2014016) was donated from the cooperation project of the Faculty of Biological Sciences, University of Malaysia.

[0035] Wash G. pannorum spores from the 10-day-cultivated PDA slant with sterile water, inoculate liquid medium, and culture at 20°C for 7 days to collect mycelia for genome extraction: inoculate milk powder solid medium with a toothpick, and culture at 20°C After 5 days, the hyphae were collected for total RNA extraction.

[0036] 1.2 Genome Extraction

[0037] Follow the instructions of the Omega Fungal Genome Extraction Kit.

[0038] 1.3 Total RNA extraction

[0039] Follow the instructions of the Takara RNA extraction kit.

[0040] 1.4 cDNA first-strand synthesis

[0041] Using the extract...

Embodiment 2

[0069] Embodiment 2 Contains the construction of the Aspergillus oryzae recombinant expression vector of aspartic acid protease gene and its transformation

[0070] 2.1 Primer design

[0071] SKP10f: 5'CTAGCTAGCTAGATGCCTTCTTCGGCGGCCGT3'

[0072] SKP10r: 5'TCCCCCGGGGGATCAAACAACAATCAACAATC 3'

[0073] 2.2 Construction of recombinant expression vector

[0074] Use the pSKNHG with the open reading frame of the aspartate protease gene as a template, and use the primers shown in 2.1 to carry out PCR amplification; the PCR product is double-digested with NheI and SmaI, and then mixed with rice Aspergillus expression vector pSKNHG was ligated and screened to obtain a recombinant plasmid (pSKNHGP10).

[0075] 2.3 Preparation of Aspergillus oryzae Competent Cells

[0076] Aspergillus oryzae slant spores were washed with sterile water, inserted into liquid medium, and cultured overnight.

[0077] When a large number of tiny mycelia appear in the medium, stop the culture, filter the ...

Embodiment 3

[0086] Induced expression and purification of embodiment 3 Aspergillus oryzae recombinant bacteria

[0087] 3.1 Pick a single clone of the recombinant bacteria on the MM plate described in 2.5, inoculate the dextrin-induced liquid medium, and culture at 20°C and 200 rpm for 3 to 5 days.

[0088] 3.2 Collect the supernatant by suction filtration through the membrane, measure the enzyme activity, determine the protein concentration, and conduct protein electrophoresis.

[0089] 3.3 The collected supernatant was first loaded onto a Ni-NTA affinity column with a column volume of 1 mL with 10 mL of NPI solution containing 10 mM imidazole at a rate of 1.0 mL / min. Then use NPI-enzyme solution, NPI solutions containing 20mM, 50mM, and 200mM to elute the affinity column in turn, measure the enzyme activity of the eluate and perform SDS-PAGE electrophoresis to determine the optimal purification conditions and obtain pure GpP10 protein ,Such as figure 1 shown.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides aspartic protease and an encoding gene and an application thereof. The aspartic protease is a protein shown as (a) or (b), wherein (a) is constituted by an amino acid residue sequence shown as SEQ ID NO:3, or (b) is obtained by performing substitution and / or deletion and / or addition of one or more amino acid residues on the amino acid residue sequence shown as SEQ ID NO:3, has the functions of the aspartic protease and is derived from (a). Through a gene engineering technology, an aspartic protease gene is amplified from Geomycespannorum, and is transferred into Aspergillus oryzae, thereby realizing successful heterologous expression. The aspartic protease provided by the invention has a relatively high optimal reaction temperature, high thermal stability and a good industrial application prospect.

Description

technical field [0001] The invention relates to the technical field of bioengineering, in particular to an aspartic acid protease, its coding gene and application. Background technique [0002] Aspartic protease (EC3.4.23) is an endo-amylase whose active center consists of two catalytic aspartic acid residues. It widely exists in animals, plants, and microorganisms, and is an industrial enzyme that has a wide range of applications in food, wine, beverage, pharmaceutical and other industries. At present, 120 kinds of aspartic acid proteases have been isolated and identified, and the aspartic acid proteases derived from microorganisms account for the majority in terms of quantity. Microorganisms that can produce acid protease include: Bacillus, Thermomonospor, Acinetobacter, Pseudomonas, Streptomyces, Aspergillus, Penicillus, etc. Aspartic acid proteases widely used in industry are mainly derived from Bacillus subtilis, Bacillus licheniformis, Aspergillus niger and Aspergill...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N9/58C12N15/57C12N15/80C12N1/15C12R1/69
CPCC12N9/58C12Y304/23
Inventor高蓓魏东芝贺磊张鲁嘉
OwnerEAST CHINA UNIV OF SCI & TECH