Unlock instant, AI-driven research and patent intelligence for your innovation.

RAA primer and probe for detecting hendra virus diseases, and detection method

A probe and probe sequence technology, applied in biochemical equipment and methods, DNA/RNA fragments, recombinant DNA technology, etc., can solve the problems of expensive instruments, high personnel requirements, long detection time, etc., to reduce detection costs, Reduce detection time, the effect of short detection time

Inactive Publication Date: 2020-04-03
CHINA ANIMAL HEALTH & EPIDEMIOLOGY CENT +1
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0009] In conventional virus detection methods, virus isolation and identification, serum neutralization test (SNT) are difficult to be widely used, and are not suitable for large-scale epidemiological investigation or on-site rapid diagnosis
However, the enzyme-linked immunosorbent assay (ELISA) has poor specificity, cross-reactivity, and false positives.
Although the fluorescent quantitative PCR method has high specificity, sensitivity and good repeatability, it still has the problems of expensive and huge equipment, high requirements for experimental sites and personnel, it is difficult to apply to large-scale on-site screening, and the detection time is too long. It takes 1 to 2 hours
All of the above-mentioned methods are not suitable to be carried out under field conditions or in quarantine stations, and require highly skilled staff and well-equipped laboratories; therefore, based on the disadvantages of long time, inconvenient operation, and high false positives of existing detection technologies, it is provided An accurate, sensitive, easy-to-operate RAA fluorescence method suitable for on-site rapid detection of HeV is an urgent problem to be solved by those skilled in the art

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • RAA primer and probe for detecting hendra virus diseases, and detection method
  • RAA primer and probe for detecting hendra virus diseases, and detection method
  • RAA primer and probe for detecting hendra virus diseases, and detection method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0047]Select the conserved sequence of HeV N gene for primer and probe design Find the corresponding whole gene sequence in Genebank (www.ncbi.nlm.nih.gov), use DNASTAR software for homology analysis and Blast sequence analysis, and screen out HeVN gene The highly conserved sequences are as follows:

[0048] CTGATGGAGGTAAAGAAAGGCGGATCAGCTAAAGGAAGGGCCGTTGAGATAATATCTGACATAGGAAATTATGTCGAGGAAACAGGAATGGCCGGCTTCTTTGCGACTATCAGATTCGGTCTTGAAACAAGATACCCTGCACTTGCCCTCAATGAGTTCCAGAGTGATCTCAAAGGGCTGATGCTGCTCTACAQGAAATAGGGCCTCGAG(

[0049] The highly conserved sequence obtained by screening is used as the target gene fragment for detection, and primers and probes are designed for screening and detection.

[0050] According to the above conserved sequence of HeV N gene, Sangon Bioengineering (Shanghai) Co., Ltd. was commissioned to synthesize a DNA plasmid with a size of 6595bp.

[0051] (1) Primer design

[0052] Design primers for RAA method detection, the length of upstream primer and do...

Embodiment 2

[0083] The method that RAA fluorescence method detects HeV virus, comprises the steps:

[0084] (1) Homogenize the tissue of the sample to be tested, extract nucleic acid according to the method of tissue extraction DNA, and store it at -20°C for later use; if the sample is whole blood, serum, or plasma, use steps such as lysis, magnetic bead enrichment, washing, and elution to extract nucleic acid ;

[0085] (2) Turn on the constant temperature fluorescent gene detector RAA-F1620 for preheating, and set the reaction parameters. The reaction parameters are set to 39°C, and the reaction time is 20 minutes;

[0086] (3) Add 13.7 μL of water to 25 μL of reaction buffer, 2.1 μL of upstream and downstream primers and 0.6 μL of probe at a concentration of 15 μM, mix well and add to the RAA fluorescent basic reaction reagent and mix to obtain a reaction master mix;

[0087] (4) Add 2.5 μL of Mg to the cap of the reaction tube 2+ , fully mixing 4 μL of the nucleic acid extraction so...

Embodiment 3

[0153] Embodiment 3 actual sample detection

[0154] (1) The sequences of primers, probes and negative quality controls are the same as in Example 1.

[0155] (2) A total of 14 clinical samples 1 to 14 in the experiment were provided by the National Center for Research on Exotic Animal Diseases;

[0156] (3) Sample extraction method:

[0157] Homogenize the tissue samples first, and then extract nucleic acid according to the Tiangen commercial tissue DNA extraction method; extract nucleic acid from serum and plasma by lysing, magnetic bead enrichment, washing, elution and other steps; store at -20°C for later use;

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a primer and probe for detecting hendra virus diseases with an RAA fluorescence method, and a detection method. The primer and probe are suitable for RAA fluorescence method detection, can accurately detect hendra virus plasmid and have no cross reaction with nipah virus plasmid, equine influenza viruses, equine arteritis viruses and equine infectious anemia viruses, and specificity can reach 100%; the detection method can rapidly and easily realize high throughput, so that detection time and costs can be reduced; and the provided method for rapidly detecting the hendravirus diseases based on the RAA fluorescence method is high in sensitivity, and the sensitivity of reaction detection can reach 39 copies / reaction with a probability of 95%.

Description

technical field [0001] The invention belongs to the technical field of virus detection, and in particular relates to a primer, a probe and a detection method for detecting Hendra virus by RAA fluorescence method. Background technique [0002] Hendra virus disease (HeV) can cause acute febrile illness. Horses are characterized by fever, increased respiratory rate, and a large amount of nasal secretions, sometimes jaundice and neurological symptoms, and eventually die. Horses are the only domestic animals that are naturally infected with HeV. Humans can also be infected with HeV. The large fruit bat is the natural host of HeV. HeV, a member of the Paramyxoviridae subfamily Paramyxoviridae, was originally known as equine measles virus and was later reclassified as Henipa. During the initial outbreak, horse trainers may have inadvertently transmitted the virus to horses or others due to their close contact with horses. In horses, the incidence of HeV is low and the fatality ra...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/70C12Q1/6844C12N15/11
CPCC12Q1/701C12Q1/6844
Inventor 吴晓东樊晓旭赵洋胡永新蔡禹希郭利川应清界李林赵永刚王志亮马洪超
Owner CHINA ANIMAL HEALTH & EPIDEMIOLOGY CENT