RAA primer and probe for detecting hendra virus diseases, and detection method
A probe and probe sequence technology, applied in biochemical equipment and methods, DNA/RNA fragments, recombinant DNA technology, etc., can solve the problems of expensive instruments, high personnel requirements, long detection time, etc., to reduce detection costs, Reduce detection time, the effect of short detection time
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0047]Select the conserved sequence of HeV N gene for primer and probe design Find the corresponding whole gene sequence in Genebank (www.ncbi.nlm.nih.gov), use DNASTAR software for homology analysis and Blast sequence analysis, and screen out HeVN gene The highly conserved sequences are as follows:
[0048] CTGATGGAGGTAAAGAAAGGCGGATCAGCTAAAGGAAGGGCCGTTGAGATAATATCTGACATAGGAAATTATGTCGAGGAAACAGGAATGGCCGGCTTCTTTGCGACTATCAGATTCGGTCTTGAAACAAGATACCCTGCACTTGCCCTCAATGAGTTCCAGAGTGATCTCAAAGGGCTGATGCTGCTCTACAQGAAATAGGGCCTCGAG(
[0049] The highly conserved sequence obtained by screening is used as the target gene fragment for detection, and primers and probes are designed for screening and detection.
[0050] According to the above conserved sequence of HeV N gene, Sangon Bioengineering (Shanghai) Co., Ltd. was commissioned to synthesize a DNA plasmid with a size of 6595bp.
[0051] (1) Primer design
[0052] Design primers for RAA method detection, the length of upstream primer and do...
Embodiment 2
[0083] The method that RAA fluorescence method detects HeV virus, comprises the steps:
[0084] (1) Homogenize the tissue of the sample to be tested, extract nucleic acid according to the method of tissue extraction DNA, and store it at -20°C for later use; if the sample is whole blood, serum, or plasma, use steps such as lysis, magnetic bead enrichment, washing, and elution to extract nucleic acid ;
[0085] (2) Turn on the constant temperature fluorescent gene detector RAA-F1620 for preheating, and set the reaction parameters. The reaction parameters are set to 39°C, and the reaction time is 20 minutes;
[0086] (3) Add 13.7 μL of water to 25 μL of reaction buffer, 2.1 μL of upstream and downstream primers and 0.6 μL of probe at a concentration of 15 μM, mix well and add to the RAA fluorescent basic reaction reagent and mix to obtain a reaction master mix;
[0087] (4) Add 2.5 μL of Mg to the cap of the reaction tube 2+ , fully mixing 4 μL of the nucleic acid extraction so...
Embodiment 3
[0153] Embodiment 3 actual sample detection
[0154] (1) The sequences of primers, probes and negative quality controls are the same as in Example 1.
[0155] (2) A total of 14 clinical samples 1 to 14 in the experiment were provided by the National Center for Research on Exotic Animal Diseases;
[0156] (3) Sample extraction method:
[0157] Homogenize the tissue samples first, and then extract nucleic acid according to the Tiangen commercial tissue DNA extraction method; extract nucleic acid from serum and plasma by lysing, magnetic bead enrichment, washing, elution and other steps; store at -20°C for later use;
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


