Application of rice gene oshxk9 in regulating seed dormancy
A technology of rice seeds and genes, applied in the fields of application, genetic engineering, plant genetic improvement, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0029] Example 1 OsHXK9 gene knockout vector construction
[0030] Based on the genome (SEQ ID NO.1) sequence, search for a specific target sequence online (http: / / crispr.dbcls.jp / ), select the target sequence "GCACCAGAGGCAACGTCGGG", and synthesize complementary primers based on the target sequence:
[0031] Upstream primer: 5'-GGCAGCACCAGAGGCAACGTCGGG-3';
[0032] Downstream primer: 5'-AAACCCCGACGTTGCCTCTGGTGC-3';
[0033] The above primers are fused in a PCR machine to obtain a fusion fragment containing the target sequence.
[0034] The vector pHun4c12 was digested with BsaI restriction endonuclease, and the linearized vector was obtained by gel recovery. The above fusion fragment was ligated into the linearized pHun4c12 (Xu et al., 2014, Gene targeting using the Agrobacterium tumefaciens-mediated CRISPR-Cas system in rice.Rice 7:5), the correct vector was obtained by enzyme digestion and further sequencing confirmed that the target sequence had been introduced Vector, t...
Embodiment 2
[0035] Example 2 Obtaining OsHXK9 gene knockout transgenic pure line oshxk9
[0036] Step 1 Genetic Transformation of Transgenic Rice
[0037] Rice genetic transformation refers to the method of Pan et al. (2006) with slight changes.
[0038] The brief description is as follows: the sterilized Qianjiang No. 6 B seeds were inoculated to 2.5mg L -1 2,4-D N 6 Culture medium, induce callus under continuous light conditions at 32°C for 7-10 days; take about 40 μL of EHA105 Agrobacterium liquid containing pHXK9 plasmid and add 25 mg L -1 Rif and 50mg L -1 In 20mL of Kan's LB liquid medium, the bacterial cells were collected by centrifugation after overnight shaking culture at 28°C, 10mM MgSO 4 Centrifuge the resuspended bacteria, remove the supernatant and resuspend with AA liquid medium containing 200 μM AS to the OD of the bacterial solution 600 =0.1~0.2; after infecting the above callus in the bacterial solution for 30min, transfer the callus to sterile filter paper to abso...
Embodiment 3
[0042] Example 3 Comparative Analysis of Ear Germination of OsHXK9 Gene Knockout Transgenic Pure Line oshxk9
[0043] The wild-type rice Qianjiang 6B and oshxk9 were planted in the field with normal fertilizer and water management. After the rice matured, 20 individual plants were randomly selected for seed testing. The results showed that there was no significant difference between the two (Table 1).
[0044] Table 1 The main agronomic traits of the mutant and its wild type
[0045]
[0046] Then, the mature rice ears were placed in a petri dish to carry out a germination test at 30 degrees, and the ear germination rate was counted every other day. The results showed that the panicle germination of oshxk9 was significantly delayed ( figure 2 ), wherein the ear germination rate of the wild type reached 98.24% on the 4th day, while the mutant did not germinate substantially at this time ( figure 2 A), starting from the 5th day, the mutants germinated successively until t...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More