Supercharge Your Innovation With Domain-Expert AI Agents!

Aptamer with xanthine oxidase inhibitory activity and application thereof

A technology of xanthine oxidase and nucleic acid aptamer, which is applied in the directions of organic active ingredients, medical preparations containing active ingredients, pharmaceutical formulations, etc., can solve problems such as poor specificity, adverse reactions, allergic syndrome, etc., and achieves low cost Effect

Active Publication Date: 2020-04-10
GUANGDONG UNIV OF PETROCHEMICAL TECH
View PDF5 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the specificity of the drug is poor, and it also inhibits other purine and pyrimidine metabolizing enzymes, causing adverse reactions of varying degrees, and even fatal allergic syndrome
Physicians and patients often struggle with limited choice of xanthine oxidase inhibitors and adverse effects

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Aptamer with xanthine oxidase inhibitory activity and application thereof
  • Aptamer with xanthine oxidase inhibitory activity and application thereof
  • Aptamer with xanthine oxidase inhibitory activity and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] Using magnetic beads-SELEX combined with capillary electrophoresis-SELEX technology to screen the nucleic acid aptamers of xanthine oxidase:

[0025] 1. The primer sequences used in the detection are as follows:

[0026] Batch amplification primerI: FAM-5'-AGCAGCACAGAGGTCAGATG-3'

[0027] Batch amplification primer II: 5'-AAAAAAAAAAAAAAAAAAA-spacer 18-TTCACGGTAGCACGCATAGG-3'

[0028] Quantitative amplification of Q-PCR primerI: 5'-GCAGCACAGAGGTCAGATG-3'

[0029] Quantitative amplification of Q-PCR primerII: 5'-TTCACGGTAGCACGCATAGG-3'

[0030] High-throughput sequencing primers are listed in Table 1:

[0031] Table 1 High-throughput sequencing primers

[0032]

[0033] 2. Preparation of xanthine oxidase-coated magnetic beads:

[0034] ①Take 100 μL of magnetic beads, wash 3 times with 100 μL boric acid-borax buffer, add 50 μL EDC+50 μL NHS, shake and mix for 30 minutes, remove the supernatant, and wash the magnetic beads twice with 100 μL boric acid-borax buffer; ...

Embodiment 2

[0052] Detection of the inhibition of xanthine oxidase activity by the nucleotide aptamer TGCCTTACGTGTGGTTGGCCTATGCGTGCTACCGTGAAAG in Example 1 above:

[0053] 1. Raw material selection: select the nucleotide sequence TGCCTTACGTGTGGTTGGCCTATGCGTGCTACCGTGAAAG in the above-mentioned embodiment 1, and the equal-length control nucleic acid sequence (A 40 , 40 adenosine monophosphates), the activity detection is carried out by using xanthine oxidase derived from bovine milk;

[0054] 2. Detection: On a 96-well enzyme plate, establish a xanthine oxidase activity analysis system according to Table 3, and set 5 parallel wells in each group. Use a microplate reader to record the absorbance A at 295 nm every 15 s for a total of 300 s. Inhibition rate (%) was calculated using the following formula: inhibition rate (%)=[(dA / dt) blank-(dA / dt) experiment] / (dA / dt) blank×100. Where (dA / dt) blank is the reaction rate of the blank group, and (dA / dt) experiment is the reaction rate of the expe...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

Relating to the technical field of screening and application of aptamers, the invention provides an aptamer with xanthine oxidase inhibitory activity and application thereof. The DNA molecule of a nucleotide sequence of the aptamer is: TGCCTTACGTGGGCCTA TGCGTGCTACCGTGAAAG or a complementary sequence thereof, the aptamer with xanthine oxidase inhibitory activity is obtained through screening by combining magnetic bead-SELEX with capillary electrophoresis-SELEX technology, and can be applied to preparation of xanthine oxidase inhibitors or uric acid-lowering drugs. The invention overcomes the defects in the prior art, the aptamer has remarkable xanthine oxidase inhibition activity and uric acid reduction activity, can be used as a health care product and a drug lead compound for diseases like gout, hyperuricemia, coronary atherosclerotic heart disease, chronic heart failure, myocardial infarction, hypertensive disease, etc., and has good application prospects.

Description

technical field [0001] The invention relates to the technical field of screening and application of nucleic acid aptamers, in particular to a nucleic acid aptamer with xanthine oxidase inhibitory activity and its application. Background technique [0002] Xanthine oxidase is an enzyme that catalyzes the oxidation of hypoxanthine to xanthine, and further catalyzes the oxidation of xanthine to uric acid. Xanthine oxidase is closely related to the pathological state of many diseases, such as gout, hepatitis, ischemia-reperfusion, inflammation, cancer and aging. Xanthine oxidase inhibitors can effectively alleviate and treat the above diseases. At present, the widely used xanthine oxidase inhibitor is mainly allopurinol. It can reduce the content of uric acid in the blood and has a good effect on the control of gout. However, the specificity of this drug is poor, and it also has inhibitory effect on other purine and pyrimidine metabolizing enzymes, thus causing various degree...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/115C12N15/10A61K31/7088A61P19/06A61P9/10A61P9/12A61P9/04A23L33/13
CPCC12N15/115C12N15/1048A61K31/7088A61P19/06A61P9/10A61P9/12A61P9/04A23L33/13C12N2310/16C12N2320/30Y02A50/30
Inventor 张强王丽任重娟唐伟绩迟恩忠童汉清赵俊仁海金萍熊岑郭先霞
Owner GUANGDONG UNIV OF PETROCHEMICAL TECH
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More