Aptamer with xanthine oxidase inhibitory activity and application thereof
A technology of xanthine oxidase and nucleic acid aptamer, which is applied in the directions of organic active ingredients, medical preparations containing active ingredients, pharmaceutical formulations, etc., can solve problems such as poor specificity, adverse reactions, allergic syndrome, etc., and achieves low cost Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0024] Using magnetic beads-SELEX combined with capillary electrophoresis-SELEX technology to screen the nucleic acid aptamers of xanthine oxidase:
[0025] 1. The primer sequences used in the detection are as follows:
[0026] Batch amplification primerI: FAM-5'-AGCAGCACAGAGGTCAGATG-3'
[0027] Batch amplification primer II: 5'-AAAAAAAAAAAAAAAAAAA-spacer 18-TTCACGGTAGCACGCATAGG-3'
[0028] Quantitative amplification of Q-PCR primerI: 5'-GCAGCACAGAGGTCAGATG-3'
[0029] Quantitative amplification of Q-PCR primerII: 5'-TTCACGGTAGCACGCATAGG-3'
[0030] High-throughput sequencing primers are listed in Table 1:
[0031] Table 1 High-throughput sequencing primers
[0032]
[0033] 2. Preparation of xanthine oxidase-coated magnetic beads:
[0034] ①Take 100 μL of magnetic beads, wash 3 times with 100 μL boric acid-borax buffer, add 50 μL EDC+50 μL NHS, shake and mix for 30 minutes, remove the supernatant, and wash the magnetic beads twice with 100 μL boric acid-borax buffer; ...
Embodiment 2
[0052] Detection of the inhibition of xanthine oxidase activity by the nucleotide aptamer TGCCTTACGTGTGGTTGGCCTATGCGTGCTACCGTGAAAG in Example 1 above:
[0053] 1. Raw material selection: select the nucleotide sequence TGCCTTACGTGTGGTTGGCCTATGCGTGCTACCGTGAAAG in the above-mentioned embodiment 1, and the equal-length control nucleic acid sequence (A 40 , 40 adenosine monophosphates), the activity detection is carried out by using xanthine oxidase derived from bovine milk;
[0054] 2. Detection: On a 96-well enzyme plate, establish a xanthine oxidase activity analysis system according to Table 3, and set 5 parallel wells in each group. Use a microplate reader to record the absorbance A at 295 nm every 15 s for a total of 300 s. Inhibition rate (%) was calculated using the following formula: inhibition rate (%)=[(dA / dt) blank-(dA / dt) experiment] / (dA / dt) blank×100. Where (dA / dt) blank is the reaction rate of the blank group, and (dA / dt) experiment is the reaction rate of the expe...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com