Application of NDUFA13 in preparation of spontaneous hepatitis-liver fibrosis animal model and preparation of drugs
A technology of liver fibrosis and animal models, which is applied in the fields of preparing drugs, diagnostic reagents and building animal models, and can solve problems such as unclear relationships
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0058] Example 1 Design and Construction of NDUFA13 Targeting Vector Plasmid
[0059] 1. Amplify mouse genome fragments from BAC clones with high-fidelity DNA polymerase and assemble them into targeting vectors together with recombination sites and selectable markers, such as figure 1 shown.
Embodiment 2
[0060] Example 2 transgene
[0061] 1. The targeting vector was electroporated into C57BL / 6ES cells, and 96 (one 96-well plate) G418-resistant clones were selected. The results of genetic recombination such as figure 2 shown. PCR screening strategies such as image 3 shown. PCR assay was performed using mNdufa_3'PCR_F / mNdufa_3'PCR_R and mNdufa_LoxP_F / mNdufa_LoxP_R primers. details as follows:
[0062] (1) 3'Arm PCR primer sequence
[0063] mNdufa_3'PCR_F:GCTGACCGCTTCCTCGTGCTTTA mNdufa_3'PCR_R:ACCATGCCTGGAATGAGACCCTAT The resulting fragment size was 3.7 kb.
[0064] (2) LoxP Site PCR primer sequence
[0065]
[0066] Such as Figure 4 As shown in A, there are 21 positive clones identified by 3'Arm PCR primers: 1A2, 1C2, 1F1, 1F2, 1G1, 1G2, 1H2, 1A3, 1B3, 1C3, 1D3, 1E4, 1G3, 1G4, 1H3, 1C5, 1C6 , 1F5, 1G5, 1H5 and 1H6. The above 21 positive clones were identified by LoxP Site PCR primers, such as Figure 4 As shown in B, there are 9 positive...
Embodiment 3
[0068] Example 3 NDUFA13 flox / - Cage Breeding and Identification of Alb-cre Mouse Strain
[0069] 1. NDUFA13 flox / - Alb-cre mouse breeding
[0070] (1) The above NDUFA13 flox / - Mice were co-caged with Alb-cre mice to obtain NDUFA13 flox / - Alb-cre mice.
[0071] 2. NDUFA13 flox / - Alb-cre mouse genotype identification
[0072] (1) After putting on sterile gloves, masks, caps, and sterile clothes, enter the SPF level animal laboratory. Use a sterilized instrument to mark the ear of the mouse, and take a 3-5mm mouse tail into a 1.5ml Ep tube with the corresponding number, add 200uL lysis buffer (10μm Tris-HCl pH8.0, 10μm EDTA, 15mM NaCl, 0.5% SDS) And 4uL proteinase k, 55 ℃ constant temperature digestion overnight. Centrifuge at 14000g for 10min, mix 100uL supernatant with an equal volume of isopropanol, vortex for 10-20s, centrifuge at 14000g for 15min, discard the supernatant, add 70% alcohol to wash the precipitate, vortex for 10-20s, centrifuge at 14000g for 10min, dis...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


