High-specific-activity acidic mannase mutant
A technology of mannanase and mutants, which is applied in the field of acidic mannanase mutants, can solve the problems of low mannanase production and inability to meet industrial production, and achieve accelerated wide application, increased specific activity, and reduced production cost effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0051] Embodiment 1 Amplification of wild-type acid mannanase gene
[0052] Aspergillus niger ( Aspergillus niger ) genome as a template for PCR amplification, the PCR primers M20-F1 and M20-R1 are as follows:
[0053] M20-F1: GCT GAATTC GGCCTCCAATTCACCATTGATGGCG (the underline is the restriction endonuclease EcoRI recognition site)
[0054] M20-R1: CTG GCGGCCGC TTAGGCGCTATCAATAGCAG (the underline is the restriction endonuclease NotI recognition site)
[0055] The PCR product was recovered by gel, connected to the pEASY-T vector, transformed into Escherichia coli DH5α, and the correct transformant was picked for sequencing. Sequencing results showed that the nucleotide sequence of the amplified gene fragment was SEQ ID NO: 2, and the encoded amino acid sequence was SEQ ID NO: 1. Through NCBI BLAST comparison, it was found that the sequence similarity between SEQ ID NO: 1 and the acid mannanase from Aspergillus niger was as high as 100%, so it was determined that the ge...
Embodiment 2
[0056] Example 2 Construction of Pichia pastoris engineering strains recombinantly expressing wild-type acid mannanase
[0057] The acid mannanase M20 gene described in Example 1 was connected to the expression vector pPIC9K through the EcoRI and Not I sites to construct the expression vector pPIC9K-M20.
[0058] The expression vector pPIC9K-M20 was linearized with Sal I, and the linearized fragment of the expression plasmid was transformed into the host cell Pichia pastoris GS115 by electroporation, and the recombinant strain of Pichia pastoris GS115 / pPIC9K-M20 was obtained by screening on the MD plate. Multi-copy transformants were screened on YPD plates with different concentrations of geneticin.
[0059] The positive transformants obtained by screening for the recombinant expression of acid mannanase M20 were named Pichia pastoris M20 ( Pichia pastoris M20), transferred to BMGY medium, 30°C, 250 rpm shaking culture for 1 day; then transferred to BMMY medium, 30°C, 250 rp...
Embodiment 3
[0091] Example 3 Screening of High Specific Activity Acid Mannanase Mutants
[0092] In order to further improve the specific activity of acid mannanase M20, the applicant screened a large number of mutations of the enzyme by directed evolution technology.
[0093] Using the M20 gene as a template, using the primers M20-F1 and M20-R1 described in Example 1, PCR amplification was performed with the GeneMorph II Random Mutation PCR Kit (Stratagene), the PCR product was recovered from the gel, and digested with EcoRI and Not I After treatment, connect with the pET21a vector after the same digestion, transform into Escherichia coli BL21(DE3), spread on LB+Amp plate, and culture upside down at 37°C. After the transformants appear, pick them one by one into a 96-well plate with a toothpick , add 150 ul LB+Amp medium containing 0.1mM IPTG to each well, incubate at 37°C 220 rpm for about 6 hours, centrifuge to discard the supernatant, resuspend the bacteria in buffer, repeatedly freeze-...
PUM
Property | Measurement | Unit |
---|---|---|
Specific vitality | aaaaa | aaaaa |
Specific vitality | aaaaa | aaaaa |
Molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com