Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

High-specific-activity acidic mannase mutant

A technology of mannanase and mutants, which is applied in the field of acidic mannanase mutants, can solve the problems of low mannanase production and inability to meet industrial production, and achieve accelerated wide application, increased specific activity, and reduced production cost effect

Active Publication Date: 2020-05-08
山东康地恩生物科技有限公司 +1
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the yield of mannanase produced by natural strains is low, which cannot meet the needs of industrial production

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0051] Embodiment 1 Amplification of wild-type acid mannanase gene

[0052] Aspergillus niger ( Aspergillus niger ) genome as a template for PCR amplification, the PCR primers M20-F1 and M20-R1 are as follows:

[0053] M20-F1: GCT GAATTC GGCCTCCAATTCACCATTGATGGCG (the underline is the restriction endonuclease EcoRI recognition site)

[0054] M20-R1: CTG GCGGCCGC TTAGGCGCTATCAATAGCAG (the underline is the restriction endonuclease NotI recognition site)

[0055] The PCR product was recovered by gel, connected to the pEASY-T vector, transformed into Escherichia coli DH5α, and the correct transformant was picked for sequencing. Sequencing results showed that the nucleotide sequence of the amplified gene fragment was SEQ ID NO: 2, and the encoded amino acid sequence was SEQ ID NO: 1. Through NCBI BLAST comparison, it was found that the sequence similarity between SEQ ID NO: 1 and the acid mannanase from Aspergillus niger was as high as 100%, so it was determined that the ge...

Embodiment 2

[0056] Example 2 Construction of Pichia pastoris engineering strains recombinantly expressing wild-type acid mannanase

[0057] The acid mannanase M20 gene described in Example 1 was connected to the expression vector pPIC9K through the EcoRI and Not I sites to construct the expression vector pPIC9K-M20.

[0058] The expression vector pPIC9K-M20 was linearized with Sal I, and the linearized fragment of the expression plasmid was transformed into the host cell Pichia pastoris GS115 by electroporation, and the recombinant strain of Pichia pastoris GS115 / pPIC9K-M20 was obtained by screening on the MD plate. Multi-copy transformants were screened on YPD plates with different concentrations of geneticin.

[0059] The positive transformants obtained by screening for the recombinant expression of acid mannanase M20 were named Pichia pastoris M20 ( Pichia pastoris M20), transferred to BMGY medium, 30°C, 250 rpm shaking culture for 1 day; then transferred to BMMY medium, 30°C, 250 rp...

Embodiment 3

[0091] Example 3 Screening of High Specific Activity Acid Mannanase Mutants

[0092] In order to further improve the specific activity of acid mannanase M20, the applicant screened a large number of mutations of the enzyme by directed evolution technology.

[0093] Using the M20 gene as a template, using the primers M20-F1 and M20-R1 described in Example 1, PCR amplification was performed with the GeneMorph II Random Mutation PCR Kit (Stratagene), the PCR product was recovered from the gel, and digested with EcoRI and Not I After treatment, connect with the pET21a vector after the same digestion, transform into Escherichia coli BL21(DE3), spread on LB+Amp plate, and culture upside down at 37°C. After the transformants appear, pick them one by one into a 96-well plate with a toothpick , add 150 ul LB+Amp medium containing 0.1mM IPTG to each well, incubate at 37°C 220 rpm for about 6 hours, centrifuge to discard the supernatant, resuspend the bacteria in buffer, repeatedly freeze-...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Specific vitalityaaaaaaaaaa
Specific vitalityaaaaaaaaaa
Molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention relates to the technical field of protein engineering modification, and particularly provides a high-specific-activity mannase mutant. Compared with a wild type, the mannase mutant provided by the invention has the advantages that the specific activity of the mannase mutant is generally improved by 4.4%-38.97%. The specific activity of the mannase mutant is improved, the production cost of mannase is reduced favorably, wide application of the mannase in the field of feed is accelerated, and the market prospect is wide.

Description

technical field [0001] The invention belongs to the technical field of protein engineering transformation, and in particular relates to an acidic mannanase mutant with improved specific activity. Background technique [0002] Plant cell walls are mainly composed of cellulose, hemicellulose, and lignin. Mannan is an important component of plant hemicellulose. It is a linear polymer connected by β-1,4-D-mannose. The side chains of the polysaccharide mainly contain glucosyl, acetyl and hemicellulose. Lactosyl and other substituent groups. β-mannanase (β-mannanase EC3.2.1.78) is an endohydrolase that hydrolyzes mannan. It degrades the β-1,4 glycosidic bond of the mannose backbone in an endo-cutting manner and releases a short β -l,4 mannan oligosaccharides. In recent years, with the discovery of the physiological functions of mannan oligosaccharides, the rise of green feed, the enhancement of people's awareness of environmental protection, and the research on the regeneration...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/42C12N15/56C12N15/81C12N1/19C12R1/84
CPCC12N9/2494C12N15/815C12Y302/01078Y02P60/87
Inventor 吴秀秀宋嵘锡黄亦钧
Owner 山东康地恩生物科技有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com