Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Monooxygenase and application thereof in preparation of optically pure sulfoxide

A monooxygenase and amino acid technology, which is applied to monooxygenase and its application in the preparation of optically pure sulfoxide, can solve the problems of limited reaction scale, low catalytic activity, and large amount of catalyst added.

Pending Publication Date: 2020-06-02
EAST CHINA UNIV OF SCI & TECH +1
View PDF9 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although these can realize the asymmetric oxidation of omeprazole sulfide to synthesize esomeprazole, there are still problems such as low catalytic activity, large amount of catalyst added, and limited reaction scale to laboratory scale.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Monooxygenase and application thereof in preparation of optically pure sulfoxide
  • Monooxygenase and application thereof in preparation of optically pure sulfoxide
  • Monooxygenase and application thereof in preparation of optically pure sulfoxide

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0108] The present invention discloses a method for preparing the above-mentioned monooxygenase, by culturing the above-mentioned recombinant expression transformant, and then separating the monooxygenase from it.

[0109] The culture method and culture conditions of the recombinant expression transformant of the present invention are not particularly limited, and can be appropriately selected according to the host cell type and culture method and other factors according to common knowledge in the field, as long as the transformant can grow and efficiently produce The AcPSMO mutant of the monooxygenase of the present invention is sufficient. When the recombinant expression transformant of the present invention is Escherichia coli, preferably LB medium is used to cultivate the recombinant expression transformant and induce enzyme production. The medium contains peptone 10g / L, yeast extract 5g / L, and NaCl 10g / L, pH7.0. For the cultivation of recombinant expression transformants an...

Embodiment 1

[0122] Example 1 Gene cloning of the monooxygenase AcPSMO

[0123] According to the open reading frame of the monooxygenase AcPSMO, the upstream and downstream primers are designed as follows:

[0124] Upstream primer SEQ ID NO: 83:

[0125] GGGAATTC CATATG ATGACCCAGAAGATGGACTT

[0126] Downstream primer SEQ ID NO: 84:

[0127] CCC AAGCTT TTAGCTTTCGATCAGGTTGG

[0128] The underlined part of the upstream primer is the Nde I restriction site, and the underlined portion of the downstream primer is the Hind III restriction site.

[0129] The genomic DNA of Acinetobacter calcoaceticus WP_045432192.1 was used as a template for PCR amplification. PCR system: 2×Taq PCR MasterMix 25μL, upstream primer and downstream primer (10ng / μL) each 2.5μL, genomic DNA (100ng / μL) 1μL and ddH 2 O 19μL. The PCR amplification program is: pre-denaturation at 95°C for 5 minutes and then 32 cycles of the following: denaturation at 94°C for 30 seconds, annealing at 50°C for 40 seconds, extension at 72°C for 1.5 m...

Embodiment 2

[0130] Example 2 Preparation of recombinant expression plasmid and recombinant expression transformant of monooxygenase AcPSMO

[0131] Such as figure 1 As shown, the target fragment of the monooxygenase AcPSMO amplified by PCR in Example 1 and the empty pET28a plasmid were simultaneously digested with restriction enzymes Nde I and Hind III overnight, and then purified by agarose gel electrophoresis. DNA kit recovery. The recovered target fragment and the empty plasmid vector were ligated under the action of T4 DNA ligase at 4°C for 12 hours to obtain the recombinant plasmid pET28a-AcPSMO.

[0132] Transform the obtained recombinant plasmid into E.coli BL21(DE3), spread it on an LB medium plate containing 50μg / mL kanamycin, and incubate at 37°C for 12-16 hours. Perform colony PCR verification on the grown colonies. The colonies were selected and PCR amplified positive clones with a length of about 1629bp. The recombinant expression transformant E.coli BL21(DE3) / pET 28a-AcPSMO was...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses monooxygenase. An amino acid sequence of the monooxygenase is obtained through mutation of an amino acid sequence represented by SEQ ID NO:2. The monooxygenase is used for preparing chiral sulfoxide drugs, has the advantages of mild reaction conditions, environmental friendliness, high yield and product optical purity, few peroxidation products and the like and has very good industrial application prospects in production of a drug proton pump inhibitor for treating gastric ulcer.

Description

Technical field [0001] The invention relates to a non-natural thioether monooxygenase and the application of an enzymatic method to catalyze asymmetric oxidation of thioether compounds to prepare sulfoxide compounds. [0002] technical background [0003] Esomeprazole, also known as (S)-omeprazole, is chemically named 5-methoxy-2-((S)-((4-methoxy-3,5-dimethyl- 2-pyridyl)methyl)sulfinyl)-1H-benzimidazole, the chemical structure is shown in formula I. Esomeprazole is the first (S)-single configuration isomer of the proton pump inhibitor omeprazole used in clinical practice. This medicine is mainly used to treat duodenal ulcer, gastric ulcer, gastritis and digestive esophagitis. It has been clinically proven that this drug has lower toxic and side effects than racemate and (R)-omeprazole, and has better curative effect. Chemical methods use metal catalysts to asymmetrically oxidize thioether to synthesize esomeprazole, but such methods have disadvantages such as limited optical pur...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N9/02C12N15/53C12P17/16
CPCC12N9/0071C12P17/165C12P11/00C07K14/00C12R2001/01C12N1/205C12Y114/14001C12P41/002
Inventor 张龑郁惠蕾许建和吴殷琦赵骞
Owner EAST CHINA UNIV OF SCI & TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com