Monooxygenase and application thereof in preparation of optically pure sulfoxide
A monooxygenase and amino acid technology, which is applied to monooxygenase and its application in the preparation of optically pure sulfoxide, can solve the problems of limited reaction scale, low catalytic activity, and large amount of catalyst added.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
preparation example Construction
[0108] The present invention discloses a method for preparing the above-mentioned monooxygenase, by culturing the above-mentioned recombinant expression transformant, and then separating the monooxygenase from it.
[0109] The culture method and culture conditions of the recombinant expression transformant of the present invention are not particularly limited, and can be appropriately selected according to the host cell type and culture method and other factors according to common knowledge in the field, as long as the transformant can grow and efficiently produce The AcPSMO mutant of the monooxygenase of the present invention is sufficient. When the recombinant expression transformant of the present invention is Escherichia coli, preferably LB medium is used to cultivate the recombinant expression transformant and induce enzyme production. The medium contains peptone 10g / L, yeast extract 5g / L, and NaCl 10g / L, pH7.0. For the cultivation of recombinant expression transformants an...
Embodiment 1
[0122] Example 1 Gene cloning of the monooxygenase AcPSMO
[0123] According to the open reading frame of the monooxygenase AcPSMO, the upstream and downstream primers are designed as follows:
[0124] Upstream primer SEQ ID NO: 83:
[0125] GGGAATTC CATATG ATGACCCAGAAGATGGACTT
[0126] Downstream primer SEQ ID NO: 84:
[0127] CCC AAGCTT TTAGCTTTCGATCAGGTTGG
[0128] The underlined part of the upstream primer is the Nde I restriction site, and the underlined portion of the downstream primer is the Hind III restriction site.
[0129] The genomic DNA of Acinetobacter calcoaceticus WP_045432192.1 was used as a template for PCR amplification. PCR system: 2×Taq PCR MasterMix 25μL, upstream primer and downstream primer (10ng / μL) each 2.5μL, genomic DNA (100ng / μL) 1μL and ddH 2 O 19μL. The PCR amplification program is: pre-denaturation at 95°C for 5 minutes and then 32 cycles of the following: denaturation at 94°C for 30 seconds, annealing at 50°C for 40 seconds, extension at 72°C for 1.5 m...
Embodiment 2
[0130] Example 2 Preparation of recombinant expression plasmid and recombinant expression transformant of monooxygenase AcPSMO
[0131] Such as figure 1 As shown, the target fragment of the monooxygenase AcPSMO amplified by PCR in Example 1 and the empty pET28a plasmid were simultaneously digested with restriction enzymes Nde I and Hind III overnight, and then purified by agarose gel electrophoresis. DNA kit recovery. The recovered target fragment and the empty plasmid vector were ligated under the action of T4 DNA ligase at 4°C for 12 hours to obtain the recombinant plasmid pET28a-AcPSMO.
[0132] Transform the obtained recombinant plasmid into E.coli BL21(DE3), spread it on an LB medium plate containing 50μg / mL kanamycin, and incubate at 37°C for 12-16 hours. Perform colony PCR verification on the grown colonies. The colonies were selected and PCR amplified positive clones with a length of about 1629bp. The recombinant expression transformant E.coli BL21(DE3) / pET 28a-AcPSMO was...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


